YL1 (VPS72) (NM_005997) Human Untagged Clone
CAT#: SC320034
VPS72 (untagged)-Human vacuolar protein sorting 72 homolog (S. cerevisiae) (VPS72)
CNY 3,656.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CFL1; Swc2; TCFL1; YL-1; YL1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_005997.1
GGCTGCAGGTGGCGGCGCAGTCTCGGTAGGCGGTATGAGTTTGGCTGGGGGCCGGGCACC
CCGGAAGACCGCTGGGAACCGGCTTTCTGGGCTTTTGGAGGCAGAGGAGGAAGATGAGTT CTACCAGACGACTTATGGGGGTTTCACAGAGGAATCCGGAGATGATGAGTATCAAGGGGA CCAGTCAGACACAGAGGACGAAGTGGACTCTGACTTTGACATTGATGAAGGGGATGAACC ATCCAGTGATGGAGAAGCAGAAGAGCCAAGAAGGAAGCGCCGAGTAGTCACCAAGGCCTA TAAGGAACCTCTCAAGAGCTTAAGGCCTCGAAAGGTCAACACCCCGGCTGGTAGCTCTCA GAAGGCGCGAGAAGAGAAGGCACTACTGCCATTAGAACTACAAGATGACGGCTCTGACAG TCGGAAGTCTATGCGTCAGTCTACAGCTGAGCATACACGACAAACGTTCCTTCGGGTACA GGAGAGGCAGGGCCAGTCAAGACGGCGAAAGGGGCCCCACTGTGAGCGGCCACTAACCCA GGAGGAACTGCTCCGGGAGGCCAAGATCACAGAAGAGCTTAATTTACGGTCACTGGAGAC ATATGAGCGGCTCGAGGCTGATAAAAAGAAGCAGGTTCATAAGAAGCGGAAGTGCCCCGG GCCCATAATCACCTATCATTCAGTGACAGTGCCACTTGTTGGGGAGCCAGGCCCCAAGGA AGAGAACGTTGACATAGAAGGACTTGATCCTGCTCCCTCGGTGTCTGCATTGACTCCTCA TGCTGGGACTGGACCCGTCAACCCCCCTGCTCGCTGCTCACGTACCTTCATCACTTTTAG TGATGATGCAACTTTCGAGGAATGGTTCCCCCAAGGGCGGCCCCCAAAAGTCCCTGTTCG TGAGGTCTGTCCAGTGACCCATCGTCCAGCCCTATACCGGGACCCTGTTACAGACATACC CTATGCCACTGCTCGAGCCTTCAAGATCATTCGTGAGGCTTACAAGAAGTACATTACTGC CCATGGACTGCCGCCCACTGCCTCAGCCCTGGGCCCCGGCCCGCCACCTCCTGAGCCCCT CCCTGGCTCTGGGCCCCGAGCCTTGCGCCAGAAAATTGTCATTAAATGAAGAGATGTCTA GTCCTCAGAAACTTCTTTCCTGCCCTGATTGGGGCTCTTGCTGTTCCGTTTCTTCTCCCT GCTTCTCCCCTTTGTCATCTCTGATCTTTGCCTAATCTGTTTCTTTTTCCTTTTCCCCTA GTTCTTACAGGTTTCGTTGTGTTTTTTAATCTAATAAAATAGAAAGATCAAAAAAAAAAA AAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_005997 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_005997.1, NP_005988.1 |
RefSeq Size | 1324 bp |
RefSeq ORF | 1095 bp |
Locus ID | 6944 |
UniProt ID | Q15906 |
Protein Families | Transcription Factors |
Gene Summary | The protein encoded by this gene is a shared subunit of two multi-component complexes, the histone acetyltransferase complex TRRAP/TIP60 as well as the chromatin remodeling SRCAP-containing complex. The TRRAP/TIP60 complex acetylates nucleosomal histones important for transcriptional regulation, double strand DNA break repair and apoptosis. The SRCAP-containing complex catalyzes the exchange of histone H2A with the histone variant Htz1 (H2AFZ) into nucleosomes. This protein may be responsible for binding H2AFZ, which has a role in chromosome segregation. This protein may also have a role in regulating long-term hematopoietic stem cell activity. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201273 | VPS72 (Myc-DDK-tagged)-Human vacuolar protein sorting 72 homolog (S. cerevisiae) (VPS72) |
CNY 3,656.00 |
|
RC201273L1 | Lenti ORF clone of Human vacuolar protein sorting 72 homolog (S. cerevisiae) (VPS72), Myc-DDK-tagged |
CNY 6,056.00 |
|
RC201273L2 | Lenti ORF clone of Human vacuolar protein sorting 72 homolog (S. cerevisiae) (VPS72), mGFP tagged |
CNY 5,890.00 |
|
RC201273L3 | Lenti ORF clone of Human vacuolar protein sorting 72 homolog (S. cerevisiae) (VPS72), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC201273L4 | Lenti ORF clone of Human vacuolar protein sorting 72 homolog (S. cerevisiae) (VPS72), mGFP tagged |
CNY 5,890.00 |
|
RG201273 | VPS72 (tGFP-tagged) - Human vacuolar protein sorting 72 homolog (S. cerevisiae) (VPS72) |
CNY 4,370.00 |