IL17F (NM_052872) Human Untagged Clone
CAT#: SC319836
IL17F (untagged)-Human interleukin 17F (IL17F)
CNY 1,200.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 3,600.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CANDF6; IL-17F; ML-1; ML1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_052872.3
GAACACAGGCATACACAGGAAGATACATTCACAGAAAGAGCTTCCTGCACAAAGTAAGCC
ACCAGCGCAACATGACAGTGAAGACCCTGCATGGCCCAGCCATGGTCAAGTACTTGCTGC TGTCGATATTGGGGCTTGCCTTTCTGAGTGAGGCGGCAGCTCGGAAAATCCCCAAAGTAG GACATACTTTTTTCCAAAAGCCTGAGAGTTGCCCGCCTGTGCCAGGAGGTAGTATGAAGC TTGACATTGGCATCATCAATGAAAACCAGCGCGTTTCCATGTCACGTAACATCGAGAGCC GCTCCACCTCCCCCTGGAATTACACTGTCACTTGGGACCCCAACCGGTACCCCTCGGAAG TTGTACAGGCCCAGTGTAGGAACTTGGGCTGCATCAATGCTCAAGGAAAGGAAGACATCT CCATGAATTCCGTTCCCATCCAGCAAGAGACCCTGGTCGTCCGGAGGAAGCACCAAGGCT GCTCTGTTTCTTTCCAGTTGGAGAAGGTGCTGGTGACTGTTGGCTGCACCTGCGTCACCC CTGTCATCCACCGTGTGCAGTAAGAGGTGCATATCCACTCAGCTGAAGAAGCTGTAGAAA TGCCACTCCTTACCCAGTGCTCTGCAACAAGTCCTGTCTGACCCCCAATTCCCTCCACTT CACAGGACTCTTAATAAGACCTGCACGGATGGAAACAGAAAATATTCACAATGTATGTGT GTATGTACTACACTTTATATTTGATATCTAAAATGTTAGGAGAAAAATTAATATATTCAG TGCTAATATAATAAAGTATTAATAATTTAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_052872 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_052872.3, NP_443104.1 |
RefSeq Size | 808 bp |
RefSeq ORF | 492 bp |
Locus ID | 112744 |
UniProt ID | Q96PD4 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | The protein encoded by this gene is a cytokine that shares sequence similarity with IL17. This cytokine is expressed by activated T cells, and has been shown to stimulate the production of several other cytokines, including IL6, IL8, and CSF2/GM_CSF. This cytokine is also found to inhibit the angiogenesis of endothelial cells and induce endothelial cells to produce IL2, TGFB1/TGFB, and monocyte chemoattractant protein-1. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes a longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209973 | IL17F (Myc-DDK-tagged)-Human interleukin 17F (IL17F) |
CNY 1,200.00 |
|
RC209973L1 | Lenti ORF clone of Human interleukin 17F (IL17F), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC209973L2 | Lenti ORF clone of Human interleukin 17F (IL17F), mGFP tagged |
CNY 5,890.00 |
|
RC209973L3 | Lenti ORF clone of Human interleukin 17F (IL17F), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC209973L4 | Lenti ORF clone of Human interleukin 17F (IL17F), mGFP tagged |
CNY 3,600.00 |
|
RG209973 | IL17F (tGFP-tagged) - Human interleukin 17F (IL17F) |
CNY 2,800.00 |