Lactate Dehydrogenase B (LDHB) (NM_002300) Human Untagged Clone
CAT#: SC319772
LDHB (untagged)-Human lactate dehydrogenase B (LDHB), transcript variant 1
CNY 2,950.00
Cited in 2 publications. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HEL-S-281; LDH-B; LDH-H; LDHBD; TRG-5 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_002300.3
GGGGCTTGCAGAGCCGGCGCCGGAGGAGACGCACGCAGCTGACTTTGTCTTCTCCGCACG
ACTGTTACAGAGGTCTCCAGAGCCTTCTCTCTCCTGTGCAAAATGGCAACTCTTAAGGAA AAACTCATTGCACCAGTTGCGGAAGAAGAGGCAACAGTTCCAAACAATAAGATCACTGTA GTGGGTGTTGGACAAGTTGGTATGGCGTGTGCTATCAGCATTCTGGGAAAGTCTCTGGCT GATGAACTTGCTCTTGTGGATGTTTTGGAAGATAAGCTTAAAGGAGAAATGATGGATCTG CAGCATGGGAGCTTATTTCTTCAGACACCTAAAATTGTGGCAGATAAAGATTATTCTGTG ACCGCCAATTCTAAGATTGTAGTGGTAACTGCAGGAGTCCGTCAGCAAGAAGGGGAGAGT CGGCTCAATCTGGTGCAGAGAAATGTTAATGTCTTCAAATTCATTATTCCTCAGATCGTC AAGTACAGTCCTGATTGCATCATAATTGTGGTTTCCAACCCAGTGGACATTCTTACGTAT GTTACCTGGAAACTAAGTGGATTACCCAAACACCGCGTGATTGGAAGTGGATGTAATCTG GATTCTGCTAGATTTCGCTACCTTATGGCTGAAAAACTTGGCATTCATCCCAGCAGCTGC CATGGATGGATTTTGGGGGAACATGGCGACTCAAGTGTGGCTGTGTGGAGTGGTGTGAAT GTGGCAGGTGTTTCTCTCCAGGAATTGAATCCAGAAATGGGAACTGACAATGATAGTGAA AATTGGAAGGAAGTGCATAAGATGGTGGTTGAAAGTGCCTATGAAGTCATCAAGCTAAAA GGATATACCAACTGGGCTATTGGATTAAGTGTGGCTGATCTTATTGAATCCATGTTGAAA AATCTATCCAGGATTCATCCCGTGTCAACAATGGTAAAGGGGATGTATGGCATTGAGAAT GAAGTCTTCCTGAGCCTTCCATGTATCCTCAATGCCCGGGGATTAACCAGCGTTATCAAC CAGAAGCTAAAGGATGATGAGGTTGCTCAGCTCAAGAAAAGTGCAGATACCCTGTGGGAC ATCCAGAAGGACCTAAAAGACCTGTGACTAGTGAGCTCTAGGCTGTAGAAATTTAAAAAC TACAATGTGATTAACTCGAGCCTTTAGTTTTCATCCATGTACATGGATCACAGTTTGCTT TGATCTTCTTCAATATGTGAATTTGGGCTCACAGAATCAAAGCCTATGCTTGGTTTAATG CTTGCAATCTGAGCTCTTGAACAAATAAAATTAACTATTGTAGTGCGAAAAAAAAAAAAA AAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002300 |
Insert Size | 1005 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002300.3, NP_002291.1 |
RefSeq Size | 1336 bp |
RefSeq ORF | 1005 bp |
Locus ID | 3945 |
UniProt ID | P07195 |
Domains | ldh |
Protein Families | Druggable Genome |
Protein Pathways | Cysteine and methionine metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Propanoate metabolism, Pyruvate metabolism |
Gene Summary | This gene encodes the B subunit of lactate dehydrogenase enzyme, which catalyzes the interconversion of pyruvate and lactate with concomitant interconversion of NADH and NAD+ in a post-glycolysis process. Alternatively spliced transcript variants have been found for this gene. Recent studies have shown that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. Mutations in this gene are associated with lactate dehydrogenase B deficiency. Pseudogenes have been identified on chromosomes X, 5 and 13. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (1) encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (LDHB) results from translation termination at the upstream UGA stop codon, while the longer isoform (LDHBx) results from UGA stop codon readthrough to the downstream UAG termination codon. This RefSeq represents the shorter isoform (LDHB), which is localized in the cytosol. Variants 1 and 2 encode the same isoform. |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
Suppressed expression of LDHB promotes pancreatic cancer progression via inducing glycolytic phenotype
,Cui, J;Quan, M;Jiang, W;Hu, H;Jiao, F;Li, N;Jin, Z;Wang, L;Wang, Y;Wang, L;,
Med. Oncol.
,PubMed ID 25807933
[LDHB]
|
Ribosomal Readthrough at a Short UGA Stop Codon Context Triggers Dual Localization of Metabolic Enzymes in Fungi and Animals
,Stiebler, AC;Freitag, J;Schink, KO;Stehlik, T;Tillmann, BA;Ast, J;Bölker, M;,
PLoS Genet.
,PubMed ID 25340584
[LDHB]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205074 | LDHB (Myc-DDK-tagged)-Human lactate dehydrogenase B (LDHB), transcript variant 1 |
CNY 5,488.00 |
|
RC205074L1 | Lenti ORF clone of Human lactate dehydrogenase B (LDHB), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC205074L2 | Lenti ORF clone of Human lactate dehydrogenase B (LDHB), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC205074L3 | Lenti ORF clone of Human lactate dehydrogenase B (LDHB), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC205074L4 | Lenti ORF clone of Human lactate dehydrogenase B (LDHB), transcript variant 1, mGFP tagged |
CNY 7,888.00 |
|
RG205074 | LDHB (tGFP-tagged) - Human lactate dehydrogenase B (LDHB), transcript variant 1 |
CNY 7,088.00 |
其它Lactate Dehydrogenase B产品