PDCD10 (NM_145860) Human Untagged Clone
CAT#: SC319754
PDCD10 (untagged)-Human programmed cell death 10 (PDCD10), transcript variant 3
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CCM3; TFAR15 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_145860.1
GGGGGATCCGGGAGTTGAAGAGGGCTGCAAGGTGGGAAGTGAAGTCAGTGCCTCAGTTGC
TGCTTTCTCCTCTAAATCTTGGTCTCTTGTTTGGAAGTGACTAACAGCATTTTGGCATGA GAAAGCCCTAAAAAGATCAGTGTGTTTTTTGTGTCCAATTCTTTTATCACCAAAAAAGAG AAGAAATATTGCAGTGAATGAAGATTCCTCTGCATTTTAGCACTGCTTTTTCAACTGTAG TTGGCTTTTGAATGAGGATGACAATGGAAGAGATGAAGAATGAAGCTGAGACCACATCCA TGGTTTCTATGCCCCTCTATGCAGTCATGTATCCTGTGTTTAATGAGCTAGAACGAGTAA ATCTGTCTGCAGCCCAGACACTGAGAGCCGCTTTCATCAAGGCTGAAAAAGAAAATCCAG GTCTCACACAAGACATCATTATGAAAATTTTAGAGAAAAAAAGCGTGGAAGTTAACTTCA CGGAGTCCCTTCTTCGTATGGCAGCTGATGATGTAGAAGAGTATATGATTGAACGACCAG AGCCAGAATTCCAAGACCTAAACGAAAAGGCACGAGCACTTAAACAAATTCTCAGTAAGA TCCCAGATGAGATCAATGACAGAGTGAGGTTTCTGCAGACAATCAAGGATATAGCTAGTG CAATAAAAGAACTTCTTGATACAGTGAATAATGTCTTCAAGAAATATCAATACCAGAACC GCAGGGCACTTGAACACCAAAAGAAAGAATTTGTAAAGTACTCCAAAAGTTTCAGTGATA CTCTGAAAACGTATTTTAAAGATGGCAAGGCAATAAATGTGTTCGTAAGTGCCAACCGAC TAATTCATCAAACCAACTTAATACTTCAGACCTTCAAAACTGTGGCCTGAAAGTTGTATA TGTTAAGAGATGTACTTCTCAGTGGCAGTATTGAACTGCCTTTATCTGTAAATTTTAAAG TTTGACTGTATAAATTATCAGTCCCTCCTGAAGGGATCTAATCCAGGATGTTGAATGGGA TTATTGCCATCTTACACCATATTTTTGTAAAATGTAGCTTAATCATAATCTCACACTGAA GATTTTGCATCACTTTTGCTATTATCATTCTTTTAAGAATTATAAGCCAAAAGAATTTAC GCCTTAATGTGTCATTATATAACATTCCTTAAAAGAATTGTAAATATTGGTGTTTGTTTC TGACATTTTAACTTGAAAGCGATATGCTGCAAGATAATGTATTTAACAATATTTGGTGGC AAATATTCAATAAATAGTTTACATCTGTCCAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_145860 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_145860.1, NP_665859.1 |
RefSeq Size | 1212 bp |
RefSeq ORF | 639 bp |
Locus ID | 11235 |
UniProt ID | Q9BUL8 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes an evolutionarily conserved protein associated with cell apoptosis. The protein interacts with the serine/threonine protein kinase MST4 to modulate the extracellular signal-regulated kinase (ERK) pathway. It also interacts with and is phosphoryated by serine/threonine kinase 25, and is thought to function in a signaling pathway essential for vascular developent. Mutations in this gene are one cause of cerebral cavernous malformations, which are vascular malformations that cause seizures and cerebral hemorrhages. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2, and 3 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205095 | PDCD10 (Myc-DDK-tagged)-Human programmed cell death 10 (PDCD10), transcript variant 3 |
CNY 2,400.00 |
|
RC205095L1 | Lenti ORF clone of Human programmed cell death 10 (PDCD10), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC205095L2 | Lenti ORF clone of Human programmed cell death 10 (PDCD10), transcript variant 3, mGFP tagged |
CNY 4,800.00 |
|
RC205095L3 | Lenti ORF clone of Human programmed cell death 10 (PDCD10), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC205095L4 | Lenti ORF clone of Human programmed cell death 10 (PDCD10), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG205095 | PDCD10 (tGFP-tagged) - Human programmed cell death 10 (PDCD10), transcript variant 3 |
CNY 4,370.00 |