United States
Germany
Japan
United Kingdom
China
Cyclin H (CCNH) (NM_001239) Human Untagged Clone
CAT＃: SC319745
CCNH (untagged)-Human cyclin H (CCNH), transcript variant 1
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CAK; CycH; p34; p37 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001239.2
GGGGGGTGGGGGTACGGGTGTTTTACGCCAGGACGCTGATGCGTTTGGGTTCTCGTCTGC
AGACCCTCTGGACCTGGTCACGATTCCATAATGTACCACAACAGTAGTCAGAAGCGGCAC TGGACCTTCTCCAGCGAGGAGCAGCTGGCAAGACTGCGGGCTGACGCCAACCGCAAATTC AGATGCAAAGCCGTGGCCAACGGGAAGGTTCTTCCGAATGATCCAGTCTTTCTTGAGCCT CATGAAGAAATGACACTCTGCAAATACTATGAGAAAAGGTTATTGGAATTCTGTTCGGTG TTTAAGCCAGCAATGCCAAGATCTGTTGTGGGTACGGCTTGTATGTATTTCAAACGTTTT TATCTTAATAACTCAGTAATGGAATATCACCCCAGGATAATAATGCTCACTTGTGCATTT TTGGCCTGCAAAGTAGATGAATTCAATGTATCTAGTCCTCAGTTTGTTGGAAACCTCCGG GAGAGTCCTCTTGGACAGGAGAAGGCACTTGAACAGATACTGGAATATGAACTACTTCTT ATACAGCAACTTAATTTCCACCTTATTGTCCACAATCCTTACAGACCATTTGAGGGCTTC CTCATCGACTTAAAGACCCGCTATCCCATATTGGAGAATCCAGAGATTTTGAGGAAAACA GCTGATGACTTTCTTAATAGAATTGCATTGACGGATGCTTACCTTTTATACACGCCTTCC CAAATTGCCCTGACTGCCATTTTATCTAGTGCCTCCAGGGCTGGAATTACTATGGAAAGT TATTTATCAGAGAGTCTGATGCTGAAAGAGAACAGAACTTGCCTGTCACAGTTACTAGAT ATAATGAAAAGCATGAGAAACTTAGTAAAGAAGTATGAACCACCCAGATCTGAAGAAGTT GCTGTTCTGAAACAGAAGTTGGAGCGATGTCATTCTGCTGAGCTTGCACTTAACGTAATC ACGAAGAAGAGGAAAGGCTATGAAGATGATGATTACGTCTCAAAGAAATCCAAACATGAG GAGGAAGAGTGGACTGATGACGACCTGGTAGAATCTCTCTAACCATTTGAAGTTGATTTC TCAATGCTAACTAATCAAGAGAAGTAGGAAGCATATCAAACGTTTAACTTTATTTAAAAA GTATAATGTGAAAACATAAAATATATTAAAACTTTTCTATTGTTTTCTTTCCCTTTCACA GTAACTTTATGTAAAATAAACCATCTTCAAAAGAGCTAGAATACCAAAAAAAAAAAAAAA AAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001239 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001239.2, NP_001230.1 |
| RefSeq Size | 1398 bp |
| RefSeq ORF | 972 bp |
| Locus ID | 902 |
| UniProt ID | P51946 |
| Domains | CYCLIN, cyclin |
| Protein Families | Druggable Genome, Transcription Factors |
| Protein Pathways | Cell cycle, Nucleotide excision repair |
| Gene Summary | The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with CDK7 kinase and ring finger protein MAT1. The kinase complex is able to phosphorylate CDK2 and CDC2 kinases, thus functions as a CDK-activating kinase (CAK). This cyclin and its kinase partner are components of TFIIH, as well as RNA polymerase II protein complexes. They participate in two different transcriptional regulation processes, suggesting an important link between basal transcription control and the cell cycle machinery. A pseudogene of this gene is found on chromosome 4. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Nov 2010] Transcript Variant: This variant (1) differs in the 3' UTR and coding sequence compared to variant 3. The resulting isoform (1) has a shorter and distinct C-terminus compared to isoform 3. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204982 | CCNH (Myc-DDK-tagged)-Human cyclin H (CCNH), transcript variant 1 |
CNY 2,400.00 |
|
| RC204982L3 | Lenti ORF clone of Human cyclin H (CCNH), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC204982L4 | Lenti ORF clone of Human cyclin H (CCNH), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG204982 | CCNH (tGFP-tagged) - Human cyclin H (CCNH), transcript variant 1 |
CNY 4,000.00 |
其它Cyclin H产品
