C4BPB (NM_001017365) Human Untagged Clone

CAT#: SC319699

C4BPB (untagged)-Human complement component 4 binding protein, beta (C4BPB), transcript variant 3



  "NM_001017365" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-C4BPB Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C4BP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001017365.1 ATTCCCAGAAACCAGGAAATTTCTGAAACTGAGTTTTAAACCTGGCAACTCTTTTACCAT
CCCTTTGTATTTTTGCAGTTCCTCCCTATACCAGCTTCCTTACAGCTGTTCTGATTTCCT
GTCGTAAGATTTTTTCTTTTCATTTTCTCCAGGGAGGGTAAATCAATATAACCTCTTCTC
TAGAGAGGAGGTGGTTAGGTTGGTCTTAAGCAGTGTTAGAAGATCTATTTTTTTTCAAAC
CAGGTGTCTGAGCTGGGTGAATTCCAGCCTGGGGAGAGGACTTTGATCACCAGATGTTTT
TTTGGTGTGCGTGCTGTCTTATGGTTGCGTGGCGAGTTTCTGCTTCAGATGAGCACTGTC
CAGAGCTTCCTCCAGTGGACAATAGCATATTTGTCGCAAAGGAGGTGGAAGGACAGATTC
TGGGGACTTACGTTTGTATCAAGGGCTACCACCTGGTAGGAAAGAAGACCCTTTTTTGCA
ATGCCTCTAAGGAGTGGGATAACACCACTACTGAGTGCCGCTTGGGCCACTGTCCTGATC
CTGTGCTGGTGAATGGAGAGTTCAGTTCTTCAGGGCCTGTGAATGTAAGTGACAAAATCA
CGTTTATGTGCAATGACCACTACATCCTCAAGGGCAGCAATCGGAGCCAGTGTCTAGAGG
ACCACACCTGGGCACCTCCCTTTCCCATCTGCAAAAGTAGGGACTGTGACCCTCCTGGGA
ATCCAGTTCATGGCTATTTTGAAGGAAATAACTTCACCTTAGGATCCACCATTAGTTATT
ACTGTGAAGACAGGTACTACTTAGTGGGCGTGCAGGAGCAGCAATGCGTTGATGGGGAGT
GGAGCAGTGCACTTCCAGTCTGCAAGTTGATCCAGGAAGCTCCCAAACCAGAGTGTGAGA
AGGCACTTCTTGCCTTTCAGGAGAGTAAGAACCTCTGCGAAGCCATGGAGAACTTTATGC
AACAATTAAAGGAAAGTGGCATGACAATGGAGGAGCTAAAATATTCTCTGGAGCTGAAGA
AAGCTGAGTTGAAGGCAAAATTGTTGTAACACTACAGCTGAGCAGATGTAATAGAAATAA
ACCTATGAATAAATTTTCTTCTTGGTTCTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001017365
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001017365.1, NP_001017365.1
RefSeq Size 968 bp
RefSeq ORF 759 bp
Locus ID 725
UniProt ID P20851
Protein Pathways Complement and coagulation cascades
Gene Summary This gene encodes a member of a superfamily of proteins composed predominantly of tandemly arrayed short consensus repeats of approximately 60 amino acids. A single, unique beta-chain encoded by this gene assembles with seven identical alpha-chains into the predominant isoform of C4b-binding protein, a multimeric protein that controls activation of the complement cascade through the classical pathway. C4b-binding protein has a regulatory role in the coagulation system also, mediated through the beta-chain binding of protein S, a vitamin K-dependent protein that serves as a cofactor of activated protein C. The genes encoding both alpha and beta chains are located adjacent to each other on human chromosome 1 in the regulator of complement activation gene cluster. Alternative splicing gives rise to multiple transcript variants. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3), also known as A12, differs in the 5' UTR compared to variant 1. Variants 1, 3 and 5 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...