DHLAG (CD74) (NM_004355) Human Untagged Clone
CAT#: SC319602
CD74 (untagged)-Human CD74 molecule, major histocompatibility complex, class II invariant chain (CD74), transcript variant 2
CNY 3,600.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DHLAG; HLADG; Ia-GAMMA; II; p33 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_004355.2
CAGGGTCCCAGATGCACAGGAGGAGAAGCAGGAGCTGTCGGGAAGATCAGAAGCCAGTCA
TGGATGACCAGCGCGACCTTATCTCCAACAATGAGCAACTGCCCATGCTGGGCCGGCGCC CTGGGGCCCCGGAGAGCAAGTGCAGCCGCGGAGCCCTGTACACAGGCTTTTCCATCCTGG TGACTCTGCTCCTCGCTGGCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCC GGCTGGACAAACTGACAGTCACCTCCCAGAACCTGCAGCTGGAGAACCTGCGCATGAAGC TTCCCAAGCCTCCCAAGCCTGTGAGCAAGATGCGCATGGCCACCCCGCTGCTGATGCAGG CGCTGCCCATGGGAGCCCTGCCCCAGGGGCCCATGCAGAATGCCACCAAGTATGGCAACA TGACAGAGGACCATGTGATGCACCTGCTCCAGAATGCTGACCCCCTGAAGGTGTACCCGC CACTGAAGGGGAGCTTCCCGGAGAACCTGAGACACCTTAAGAACACCATGGAGACCATAG ACTGGAAGGTCTTTGAGAGCTGGATGCACCATTGGCTCCTGTTTGAAATGAGCAGGCACT CCTTGGAGCAAAAGCCCACTGACGCTCCACCGAAAGAGTCACTGGAACTGGAGGACCCGT CTTCTGGGCTGGGTGTGACCAAGCAGGATCTGGGCCCAGTCCCCATGTGAGAGCAGCAGA GGCGGTCTTCAACATCCTGCCAGCCCCACACAGCTACAGCTTTCTTGCTCCCTTCAGCCC CCAGCCCCTCCCCCATCTCCCACCCTGTACCTCATCCCATGAGACCCTGGTGCCTGGCTC TTTCGTCACCCTTGGACAAGACAAACCAAGTCGGAACAGCAGATAACAATGCAGCAAGGC CCTGCTGCCCAATCTCCATCTGTCAACAGGGGCGTGAGGTCCCAGGAAGTGGCCAAAAGC TAGACAGATCCCCGTTCCTGACATCACAGCAGCCTCCAACACAAGGCTCCAAGACCTAGG CTCATGGACGAGATGGGAAGGCACAGGGAGAAGGGATAACCCTACACCCAGACCCCAGGC TGGACATGCTGACTGTCCTCTCCCCTCCAGCCTTTGGCCTTGGCTTTTCTAGCCTATTTA CCTGCAGGCTGAGCCACTCTCTTCCCTTTCCCCAGCATCACTCCCCAAGGAAGAGCCAAT GTTTTCCACCCATAATCCTTTCTGCCGACCCCTAGTTCCCTCTGCTCAGCCAAGCTTGTT ATCAGCTTTCAGGGCCATGGTTCACATTAGAATAAAAGGTAGTAATTAGAAAAAAAAAAA AAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_004355 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_004355.2, NP_004346.1 |
RefSeq Size | 1327 bp |
RefSeq ORF | 699 bp |
Locus ID | 972 |
UniProt ID | P04233 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Antigen processing and presentation |
Gene Summary | The protein encoded by this gene associates with class II major histocompatibility complex (MHC) and is an important chaperone that regulates antigen presentation for immune response. It also serves as cell surface receptor for the cytokine macrophage migration inhibitory factor (MIF) which, when bound to the encoded protein, initiates survival pathways and cell proliferation. This protein also interacts with amyloid precursor protein (APP) and suppresses the production of amyloid beta (Abeta). Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (2) lacks an in-frame exon in the 3' coding region, compared to variant 1. The resulting isoform (b) lacks an internal segment in the C-terminal region, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205824 | CD74 (Myc-DDK-tagged)-Human CD74 molecule, major histocompatibility complex, class II invariant chain (CD74), transcript variant 2 |
CNY 3,600.00 |
|
RC205824L3 | Lenti-ORF clone of CD74 (Myc-DDK-tagged)-Human CD74 molecule, major histocompatibility complex, class II invariant chain (CD74), transcript variant 2 |
CNY 5,890.00 |
|
RC205824L4 | Lenti-ORF clone of CD74 (mGFP-tagged)-Human CD74 molecule, major histocompatibility complex, class II invariant chain (CD74), transcript variant 2 |
CNY 5,890.00 |
|
RG205824 | CD74 (tGFP-tagged) - Human CD74 molecule, major histocompatibility complex, class II invariant chain (CD74), transcript variant 2 |
CNY 5,200.00 |