ECHS1 (NM_004092) Human Untagged Clone
CAT#: SC319501
ECHS1 (untagged)-Human enoyl CoA hydratase, short chain, 1, mitochondrial (ECHS1), nuclear gene encoding mitochondrial protein
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ECHS1D; SCEH |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_004092.2
GAGTCCAGAGAGCCATGGCCGCCCTGCGTGTCCTGCTGTCCTGCGTCCGCGGCCCGCTGA
GGCCCCCGGTTCGCTGTCCCGCCTGGCGTCCCTTCGCCTCGGGTGCTAACTTTGAGTACA TCATCGCAGAAAAAAGAGGGAAGAATAACACCGTGGGGTTGATCCAACTGAACCGCCCCA AGGCCCTCAATGCACTTTGCGATGGCCTGATTGACGAGCTCAACCAGGCCCTGAAGATCT TCGAGGAGGACCCGGCCGTGGGGGCCATTGTCCTCACCGGCGGGGATAAGGCCTTTGCAG CTGGAGCTGATATCAAGGAAATGCAGAACCTGAGTTTCCAGGACTGTTACTCCAGCAAGT TCTTGAAGCACTGGGACCACCTCACCCAGGTCAAGAAGCCAGTCATCGCTGCTGTCAATG GCTATGCCTTTGGCGGGGGCTGTGAGCTTGCCATGATGTGTGATATCATCTATGCCGGTG AGAAGGCCCAGTTTGCACAGCCGGAGATCTTAATAGGAACCATCCCAGGTGCGGGCGGCA CCCAGAGACTCACCCGTGCTGTTGGGAAGTCGCTGGCGATGGAGATGGTCCTCACCGGTG ACCGGATCTCAGCCCAGGACGCCAAGCAAGCAGGTCTTGTCAGCAAGATTTGTCCTGTTG AGACACTGGTGGAAGAAGCCATCCAGTGTGCAGAAAAAATTGCCAGCAATTCTAAAATTG TAGTAGCGATGGCCAAAGAATCAGTGAATGCAGCTTTTGAAATGACATTAACAGAAGGAA GTAAGTTGGAGAAGAAACTCTTTTATTCAACCTTTGCCACTGATGACCGGAAAGAAGGGA TGACCGCGTTTGTGGAAAAGAGAAAGGCCAACTTCAAAGACCAGTGAGAACCAGCTGCCC CTGCTTCACACCTCTGCTTGGAGAGGACAAGTGCAGCCTGTCAGTTTTAGAAGCAAGTAA ATCATCCTCTTTTCAAGAGCAGTGTCCGTGGTGTGCAGTTCCTCTCCAATTGCTGCGTGG TCGTGGCCCGACCTCTCACGGCATGACAGCCTTCGTCACCCAGCCTGTGAGGGTCCTGAC TGGAGCACCTTCTAAATCTAAGATTCTGCTGAGGAGCCCCCGCTGGTCCCTCTGGGCATG CTGTGCTCGGACGGAAAGCGGGGCCTGCGGGTCCTTGTGTCCCTGCCGCTGAAGAATGGG GCTGCTCTGAGGGAAACGCTGTCTGCTGCCTTCATACAGATGCTGATTAAAGTGATAGCG ATTCAGATTACAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_004092 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_004092.2, NP_004083.2 |
RefSeq Size | 1326 bp |
RefSeq ORF | 873 bp |
Locus ID | 1892 |
UniProt ID | P30084 |
Domains | ECH |
Protein Pathways | beta-Alanine metabolism, Butanoate metabolism, Fatty acid elongation in mitochondria, Fatty acid metabolism, Limonene and pinene degradation, Lysine degradation, Metabolic pathways, Propanoate metabolism, Tryptophan metabolism, Valine, leucine and isoleucine degradation |
Gene Summary | The protein encoded by this gene functions in the second step of the mitochondrial fatty acid beta-oxidation pathway. It catalyzes the hydration of 2-trans-enoyl-coenzyme A (CoA) intermediates to L-3-hydroxyacyl-CoAs. The gene product is a member of the hydratase/isomerase superfamily. It localizes to the mitochondrial matrix. Transcript variants utilizing alternative transcription initiation sites have been described in the literature. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200369 | ECHS1 (Myc-DDK-tagged)-Human enoyl CoA hydratase, short chain, 1, mitochondrial (ECHS1), nuclear gene encoding mitochondrial protein |
CNY 2,400.00 |
|
RC200369L1 | Lenti ORF clone of Human enoyl CoA hydratase, short chain, 1, mitochondrial (ECHS1), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC200369L2 | Lenti ORF clone of Human enoyl CoA hydratase, short chain, 1, mitochondrial (ECHS1), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RC200369L3 | Lenti ORF clone of Human enoyl CoA hydratase, short chain, 1, mitochondrial (ECHS1), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC200369L4 | Lenti ORF clone of Human enoyl CoA hydratase, short chain, 1, mitochondrial (ECHS1), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RG200369 | ECHS1 (tGFP-tagged) - Human enoyl CoA hydratase, short chain, 1, mitochondrial (ECHS1), nuclear gene encoding mitochondrial protein |
CNY 4,370.00 |