ID3 (NM_002167) Human Untagged Clone
CAT#: SC319486
ID3 (untagged)-Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3)
CNY 1,200.00
CNY 2,950.00
Cited in 2 publications. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bHLHb25; HEIR-1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_002167.2
CGAGCGTGCGCGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTG
GGGCACCTCTGGACTCACTCCCCAGCATGAAGGCGCTGAGCCCGGTGCGCGGCTGCTACG AGGCGGTGTGCTGCCTGTCGGAACGCAGTCTGGCCATCGCCCGGGGCCGAGGGAAGGGCC CGGCAGCTGAGGAGCCGCTGAGCTTGCTGGACGACATGAACCACTGCTACTCCCGCCTGC GGGAACTGGTACCCGGAGTCCCGAGAGGCACTCAGCTTAGCCAGGTGGAAATCCTACAGC GCGTCATCGACTACATTCTCGACCTGCAGGTAGTCCTGGCCGAGCCAGCCCCTGGACCCC CTGATGGCCCCCACCTTCCCATCCAGACAGCCGAGCTCGCTCCGGAACTTGTCATCTCCA ACGACAAAAGGAGCTTTTGCCACTGACTCGGCCGTGTCCTGACACCTCCAGAACGCAGGT GCTGGCGCCCGTTCTGCCTGGGACCCCGGGAACCTCTCCTGCCGGAAGCCGGACGGCAGG GATGGGCCCCAACTTCGCCCTGCCCACTTGACTTCACCAAATCCCTTCCTGGAGACTAAA CCTGGTGCTCAGGAGCGAAGGACTGTGAACTTGTGGCCTGAAGAGCCAGAGCTAGCTCTG GCCACCAGCTGGGCGACGTCACCCTGCTCCCACCCCACCCCCAAGTTCTAAGGTCTTTTC AGAGCGTGGAGGTGTGGAAGGAGTGGCTGCTCTCCAAACTATGCCAAGGCGGCGGCAGAG CTGGTCTTCTGGTCTCCTTGGAGAAAGGTTCTGTTGCCCTGATTTATGAACTCTATAATA GAGTATATAGGTTTTGTACCTTTTTTACAGGAAGGTGACTTTCTGTAACAATGCGATGTA TATTAAACTTTTTATAAAAGTTAACATTTTGCATAATAAACGATTTTTAAACACTTGAAA AAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002167 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002167.2, NP_002158.2 |
RefSeq Size | 1203 bp |
RefSeq ORF | 360 bp |
Locus ID | 3399 |
UniProt ID | Q02535 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors |
Protein Pathways | TGF-beta signaling pathway |
Gene Summary | The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with other HLH proteins. However, the encoded protein lacks a basic DNA-binding domain and therefore inhibits the DNA binding of any HLH protein with which it interacts. [provided by RefSeq, Aug 2011] |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
Role of ID Proteins in BMP4 Inhibition of Profibrotic Effects of TGF-β2 in Human TM Cells
,Mody, AA;Wordinger, RJ;Clark, AF;,
Invest. Ophthalmol. Vis. Sci
,PubMed ID 28159972
[ID3]
|
ERK phosphorylation and miR-181a expression modulate activation of human memory TH17 cells
,Mele, F;Basso, C;Leoni, C;Aschenbrenner, D;Becattini, S;Latorre, D;Lanzavecchia, A;Sallusto, F;Monticelli, S;,
Nat Commun
,PubMed ID 25775432
[ID3]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200583 | ID3 (Myc-DDK-tagged)-Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3) |
CNY 1,800.00 |
|
RC200583L1 | Lenti ORF clone of Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3), Myc-DDK-tagged |
CNY 4,200.00 |
|
RC200583L2 | Lenti ORF clone of Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3), mGFP tagged |
CNY 4,200.00 |
|
RC200583L3 | Lenti ORF clone of Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3), Myc-DDK-tagged |
CNY 4,200.00 |
|
RC200583L4 | Lenti ORF clone of Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3), mGFP tagged |
CNY 4,200.00 |
|
RG200583 | ID3 (tGFP-tagged) - Human inhibitor of DNA binding 3, dominant negative helix-loop-helix protein (ID3) |
CNY 3,400.00 |