NUDT5 (NM_014142) Human Untagged Clone
CAT#: SC319410
NUDT5 (untagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 5 (NUDT5)
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | hNUDT5; YSA1; YSA1H; YSAH1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_014142.2
AAAAAGAGCTTTAGTCTCGAAAGAGGAATTACCGAAGTGTCGAGAGAGGAATTTTAAGAA
GTTTACAACTCCGTCTTCGCCCTAAACGCACGCTGACCCGGAAAGTAATCTCCTGAAGCT AGGTCAAAGGCGGGGGTTCTACGGATGCCGGAAGGAGGGTGCGCGCCCATCCTTTTAGCA CCGCGAGAGGCGCCGGTGTTTCGAGCCGTGGCACCGGCATCGGCTGACACTGCTGCCTCC AGCTAGTTATTTCGTCCTCTTCCGTTCTTCACCCCTACACCTTGGAGGTGAACTTCTCAC CTGAGGGCTGTAAAGACTCGTTTGAAAATGGAGAGCCAAGAACCAACGGAATCTTCTCAG AATGGCAAACAGTATATCATTTCAGAGGAGTTAATTTCAGAAGGAAAATGGGTCAAGCTT GAAAAAACAACGTACATGGATCCTACTGGTAAAACTAGAACTTGGGAATCAGTGAAACGT ACAACCAGGAAAGAGCAGACTGCGGATGGTGTCGCGGTCATCCCCGTGCTGCAGAGAACA CTTCACTATGAGTGTATCGTTCTGGTGAAACAGTTCCGACCACCAATGGGGGGCTACTGC ATAGAGTTCCCTGCAGGTCTCATAGATGATGGTGAAACCCCAGAAGCAGCTGCTCTCCGG GAGCTTGAAGAAGAAACTGGCTACAAAGGGGACATTGCCGAATGTTCTCCAGCGGTCTGT ATGGACCCAGGCTTGTCAAACTGTACTATACACATCGTGACAGTCACCATTAACGGAGAT GATGCCGAAAACGCAAGGCCGAAGCCAAAGCCAGGGGATGGAGAGTTTGTGGAAGTCATT TCTTTACCCAAGAATGACCTGCTGCAGAGACTTGATGCTCTGGTAGCTGAAGAACATCTC ACAGTGGACGCCAGGGTCTATTCCTACGCTCTAGCACTGAAACATGCAAATGCAAAGCCA TTTGAAGTGCCCTTCTTGAAATTTTAAGCCCAAATATGACACTGGCCATTTTTGTAAACG AGACCACCAGGCCTTCTTCACTAAGACTTTGTATTCAACTTAGTTTAATGTAGATTTGCC ATTAGCTTTTTCGTAAAATAAAAGCACAGAACAGAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_014142 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_014142.2, NP_054861.2 |
RefSeq Size | 1224 bp |
RefSeq ORF | 660 bp |
Locus ID | 11164 |
UniProt ID | Q9UKK9 |
Domains | NUDIX |
Protein Pathways | Purine metabolism |
Gene Summary | This gene belongs to the Nudix (nucleoside diphosphate linked moiety X) hydrolase superfamily. The encoded enzyme catalyzes the hydrolysis of modified nucleoside diphosphates, including ADP-ribose (ADPR) and 8-oxoGua-containing 8-oxo-dADP and 8-oxo-dGDP. Protein-bound ADP ribose can be hazardous to the cell because it can modify some amino acid residues, resulting in the inhibition of ATP-activated potassium channels. 8-oxoGua is an oxidized form of guanine that can potentially alter genetic information by pairing with adenine and cytosine in RNA. Presence of 8-oxoGua in RNA results in formation of abnormal proteins due to translational errors. [provided by RefSeq, Aug 2013] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200204 | NUDT5 (Myc-DDK-tagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 5 (NUDT5) |
CNY 2,400.00 |
|
RC200204L1 | Lenti ORF clone of Human nudix (nucleoside diphosphate linked moiety X)-type motif 5 (NUDT5), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC200204L2 | Lenti ORF clone of Human nudix (nucleoside diphosphate linked moiety X)-type motif 5 (NUDT5), mGFP tagged |
CNY 5,890.00 |
|
RC200204L3 | Lenti ORF clone of Human nudix (nucleoside diphosphate linked moiety X)-type motif 5 (NUDT5), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC200204L4 | Lenti ORF clone of Human nudix (nucleoside diphosphate linked moiety X)-type motif 5 (NUDT5), mGFP tagged |
CNY 5,890.00 |
|
RG200204 | NUDT5 (tGFP-tagged) - Human nudix (nucleoside diphosphate linked moiety X)-type motif 5 (NUDT5) |
CNY 4,000.00 |