United States
Germany
Japan
United Kingdom
China
SPHK1 (NM_021972) Human Untagged Clone
CAT＃: SC319307
SPHK1 (untagged)-Human sphingosine kinase 1 (SPHK1), transcript variant 1
CNY 5,488.00
| Cited in 2 publications. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | SPHK |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_021972.2
GCTCCGCGGCGCCGGCTGCGAAGTTGAGCGAAAAGTTTGAGGCCGGAGGGAGCGAGGCCG
GGGAGTCCGCTCCAGCGGGGCGCTCCAGTCCCTCAGACGTGGGCTGAGCTTGGGACGAGC TGCGTTCCGCCCCAGGCCACTGTAGGGAACGGCGGTGGCGCCTCCCCAGCAAACCGGACC GACTGGGTCCAGCCGCCGCAGGGAATGACACCGGTGCTCCTACAGCCACGGCTCCGGGCG GGGAAGGCGAGCCCCACAGCCGGCCCTGCGACGCCCTCCTGGGCAGCACCGATAAGGAGC TGAAGGCAGGAGCCGCCGCCACGGGCAGCGCCCCCACAGCGCCAGGGACCCCCTGGCAGC GGGAGCCGCGGGTCGAGGTTATGGATCCAGTGGTCGGTTGCGGACGTGGCCTCTTTGGTT TTGTTTTCTCAGCGGGCGGCCCCCGGGGCGTGCTCCCGCGGCCCTGCCGCGTGCTGGTGC TGCTGAACCCGCGCGGCGGCAAGGGCAAGGCCTTGCAGCTCTTCCGGAGTCACGTGCAGC CCCTTTTGGCTGAGGCTGAAATCTCCTTCACGCTGATGCTCACTGAGCGGCGGAACCACG CGCGGGAGCTGGTGCGGTCGGAGGAGCTGGGCCGCTGGGACGCTCTGGTGGTCATGTCTG GAGACGGGCTGATGCACGAGGTGGTGAACGGGCTCATGGAGCGGCCTGACTGGGAGACCG CCATCCAGAAGCCCCTGTGTAGCCTCCCAGCAGGCTCTGGCAACGCGCTGGCAGCTTCCT TGAACCATTATGCTGGCTATGAGCAGGTCACCAATGAAGACCTCCTGACCAACTGCACGC TATTGCTGTGCCGCCGGCTGCTGTCACCCATGAACCTGCTGTCTCTGCACACGGCTTCGG GGCTGCGCCTCTTCTCTGTGCTCAGCCTGGCCTGGGGCTTCATTGCTGATGTGGACCTAG AGAGTGAGAAGTATCGGCGTCTGGGGGAGATGCGCTTCACTCTGGGCACCTTCCTGCGTC TGGCAGCCCTGCGCACCTACCGCGGCCGACTGGCCTACCTCCCTGTAGGAAGAGTGGGTT CCAAGACACCTGCCTCCCCCGTTGTGGTCCAGCAGGGCCCGGTAGATGCACACCTTGTGC CACTGGAGGAGCCAGTGCCCTCTCACTGGACAGTGGTGCCCGACGAGGACTTTGTGCTAG TCCTGGCACTGCTGCACTCGCACCTGGGCAGTGAGATGTTTGCTGCACCCATGGGCCGCT GTGCAGCTGGCGTCATGCATCTGTTCTACGTGCGGGCGGGAGTGTCTCGTGCCATGCTGC TGCGCCTCTTCCTGGCCATGGAGAAGGGCAGGCATATGGAGTATGAATGCCCCTACTTGG TATATGTGCCCGTGGTCGCCTTCCGCTTGGAGCCCAAGGATGGGAAAGGTGTGTTTGCAG TGGATGGGGAATTGATGGTTAGCGAGGCCGTGCAGGGCCAGGTGCACCCAAACTACTTCT GGATGGTCAGCGGTTGCGTGGAGCCCCCGCCCAGCTGGAAGCCCCAGCAGATGCCACCGC CAGAAGAGCCCTTATGACCCCTGGGCCGCGCTGTGCCTTAGTGTCTACTTGCAGGACCCT TCCTCCTTCCCTAGGGCTGCAGAGCCTGTCCACAGCTCCTGTGGGGGTGGAGGAGACTCC TCTGGAGAAGGGTGAGAAGGTGGAGGCTATGCTTTGGGGGGACAGGCCAGAATGAAGTCC TGGGTCAGGAGCCCAGCTGGCTGGGCCCAGCTGCCTATGTAAGGCCTTCTAGTTTGTTCT GAGACCCCCACCCCACGAACCAAATCCAAATAAAGTGACATTCCCAGCCTGAAAAAAAAA AAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_021972 |
| Insert Size | 1900 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_021972.2, NP_068807.2 |
| RefSeq Size | 1869 bp |
| RefSeq ORF | 1197 bp |
| Locus ID | 8877 |
| UniProt ID | Q9NYA1 |
| Domains | DAGKc |
| Protein Families | Druggable Genome |
| Protein Pathways | Calcium signaling pathway, Fc gamma R-mediated phagocytosis, Metabolic pathways, Sphingolipid metabolism, VEGF signaling pathway |
| Gene Summary | The protein encoded by this gene catalyzes the phosphorylation of sphingosine to form sphingosine-1-phosphate (S1P), a lipid mediator with both intra- and extracellular functions. Intracellularly, S1P regulates proliferation and survival, and extracellularly, it is a ligand for cell surface G protein-coupled receptors. This protein, and its product S1P, play a key role in TNF-alpha signaling and the NF-kappa-B activation pathway important in inflammatory, antiapoptotic, and immune processes. Phosphorylation of this protein alters its catalytic activity and promotes its translocation to the plasma membrane. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2017] Transcript Variant: This variant (1) has multiple differences in the coding region, compared to variant 2. The resulting protein (isoform 1) has a shorter N-terminus and contains an additional in-frame portion of the 5' coding region, compared to isoform 2. |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Sphingosine kinase 1 overexpression stimulates intestinal epithelial cell proliferation through increased c-Myc translation
,Ping Jiang, Alexis D. Smith, Ruiyun Li, Jaladanki N. Rao, Lan Liu, James M. Donahue, Jian-Ying Wang, and Douglas J. Turner,
Am J Physiol Cell Physiol, Jun 2013; 304: C1187 - C1197.
,PubMed ID 23576579
[SphK1]
|
|
Sphingosine kinase isoforms as a therapeutic target in endocrine therapy resistant luminal and basal-A breast cancer
,James W Antoon, Martin D White, Jennifer L Driver, Matthew E Burow, and Barbara S Beckman,
Exp Biol Med, Jul 2012; 237: 832 - 844.
[SPHK1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203398 | SPHK1 (Myc-DDK-tagged)-Human sphingosine kinase 1 (SPHK1), transcript variant 1 |
CNY 5,488.00 |
|
| RC203398L1 | Lenti ORF clone of Human sphingosine kinase 1 (SPHK1), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC203398L2 | Lenti ORF clone of Human sphingosine kinase 1 (SPHK1), transcript variant 1, mGFP tagged |
CNY 7,888.00 |
|
| RC203398L3 | Lenti ORF clone of Human sphingosine kinase 1 (SPHK1), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC203398L4 | Lenti ORF clone of Human sphingosine kinase 1 (SPHK1), transcript variant 1, mGFP tagged |
CNY 7,888.00 |
|
| RG203398 | SPHK1 (tGFP-tagged) - Human sphingosine kinase 1 (SPHK1), transcript variant 1 |
CNY 7,088.00 |
