DCPS (NM_014026) Human Untagged Clone
CAT#: SC319248
DCPS (untagged)-Human decapping enzyme, scavenger (DCPS)
CNY 3,656.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARS; DCS1; HINT-5; HINT5; HSL1; HSPC015 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_014026.3
GGGGCTCCGCGTCCGCGGCAGCATGGCGGACGCAGCTCCTCAACTAGGCAAGAGGAAGCG
CGAATTGGACGTGGAGGAGGCCCACGCCGCCAGCACAGAGGAAAAGGAGGCAGGAGTTGG AAATGGTACCTGTGCTCCTGTCCGCTTACCGTTCTCCGGCTTCAGACTGCAGAAGGTGCT GAGGGAGTCTGCGCGGGACAAAATCATTTTCCTACACGGGAAGGTGAATGAGGCCTCTGA GGATGGGGATGGAGAGGATGCCGTTGTGATCCTGGAGAAGACGCCATTTCAGGTGGAACA GGTGGCTCAGCTCCTGACGGGCAGCCCTGAGCTCCAATTGCAGTTCTCCAATGATATCTA CAGCACCTATCACTTGTTCCCTCCAAGACAACTGAATGATGTAAAGACGACCGTGGTTTA CCCTGCCACAGAGAAACACCTGCAGAAGTACCTGCGCCAGGACCTCCGCCTGATCCGAGA GACGGGAGATGACTACAGGAACATTACTTTACCCCACCTGGAGTCCCAGAGCCTCAGCAT CCAGTGGGTGTATAACATTCTCGACAAGAAGGCTGAAGCGGACCGGATTGTTTTCGAGAA CCCAGATCCCTCTGATGGTTTTGTCCTCATCCCTGACCTCAAGTGGAACCAACAGCAGCT CGATGACTTGTACTTGATCGCCATCTGCCATCGCCGGGGCATCAGATCCCTACGCGACCT TACTCCGGAGCACTTGCCGCTGCTCAGGAACATCCTCCACCAGGGGCAGGAGGCCATCCT GCAGCGCTACCGGATGAAGGGAGACCATCTGCGAGTATACCTGCACTACCTGCCCTCCTA CTACCACCTGCATGTGCACTTCACCGCCCTGGGCTTCGAGGCCCCCGGCTCAGGCGTGGA GCGGGCCCACCTGCTGGCTGAGGTGATCGAGAACTTGGAGTGTGACCCTAGGCACTACCA GCAGCGCACGCTCACCTTCGCCCTCAGGGCTGACGACCCCCTGCTCAAGCTCTTGCAGGA GGCTCAGCAAAGCTGAATTAACTCAGGCAGAAGAGCACAGATGTGTGGGATTGGGGGAGG AGTGGGGACAAGATTTTTTATCTCCAAGTGAATTTTCTAAAAATGTATTTTATACCGGCT TATTCCTAGTATTGAATAAACTAGCGGGCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A |
Restriction Sites | Please inquire |
ACCN | NM_014026 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_014026.3, NP_054745.1 |
RefSeq Size | 1508 bp |
RefSeq ORF | 1014 bp |
Locus ID | 28960 |
UniProt ID | Q96C86 |
Protein Pathways | RNA degradation |
Gene Summary | This gene encodes a member of the histidine triad family of pyrophosphatases that removes short mRNA fragments containing the 5′ mRNA cap structure, which appear in the 3′ → 5′ mRNA decay pathway, following deadenylation and exosome-mediated turnover. This enzyme hydrolyzes the triphosphate linkage of the cap structure (7-methylguanosine nucleoside triphosphate) to yield 7-methylguanosine monophosphate and nucleoside diphosphate. It protects the cell from the potentially toxic accumulation of these short, capped mRNA fragments, and regulates the activity of other cap-binding proteins, which are inhibited by their accumulation. It also acts as a transcript-specific modulator of pre-mRNA splicing and microRNA turnover. [provided by RefSeq, Apr 2017] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203052 | DCPS (Myc-DDK-tagged)-Human decapping enzyme, scavenger (DCPS) |
CNY 3,656.00 |
|
RC203052L3 | Lenti ORF clone of Human decapping enzyme, scavenger (DCPS), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC203052L4 | Lenti ORF clone of Human decapping enzyme, scavenger (DCPS), mGFP tagged |
CNY 5,890.00 |
|
RG203052 | DCPS (tGFP-tagged) - Human decapping enzyme, scavenger (DCPS) |
CNY 5,256.00 |