TRAP alpha (SSR1) (NM_003144) Human Untagged Clone
CAT#: SC319121
SSR1 (untagged)-Human signal sequence receptor, alpha (SSR1)
CN¥ 2,400.00
CN¥ 2,950.00
Product images

CN¥ 1,999.00
CN¥ 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | TRAPA |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_003144.2
CGGAGCCCGGATGAAGAGTAACGCCATTACCGCCGGAGCCGCCGAGAGCCTTAGCCGACG
GAAACTGGACACTGGACCGGCAGCGCCATGAGACTCCTCCCCCGCTTGCTGCTGCTTCTC TTACTCGTGTTCCCTGCCACTGTCTTGTTCCGAGGCGGCCCCAGAGGCTTGTTAGCAGTG GCACAAGATCTTACAGAGGATGAAGAAACAGTAGAAGATTCCATAATTGAGGATGAAGAT GATGAAGCCGAGGTAGAAGAAGATGAACCCACAGATTTGGTAGAAGATAAAGAGGAAGAA GATGTGTCTGGTGAACCTGAAGCTTCACCGAGTGCAGATACAACTATACTGTTTGTAAAA GGAGAAGATTTTCCAGCAAATAACATTGTGAAGTTCCTGGTAGGCTTTACCAACAAGGGT ACAGAAGATTTTATTGTTGAATCCTTAGATGCCTCATTCCGTTATCCTCAGGACTACCAG TTTTATATCCAGAATTTCACAGCTCTTCCTCTGAACACTGTAGTGCCACCCCAGAGACAG GCAACTTTTGAGTACTCTTTCATTCCTGCAGAGCCCATGGGCGGACGACCATTTGGTTTG GTCATCAATCTGAACTACAAAGATTTGAACGGCAATGTATTCCAAGATGCAGTCTTCAAT CAAACAGTTACAGTTATTGAAAGAGAGGATGGGTTAGATGGAGAAACAATCTTTATGTAT ATGTTCCTTGCTGGTCTTGGGCTTCTGGTTATTGTTGGCCTTCATCAACTCCTAGAATCT AGAAAGCGTAAGAGACCCATACAGAAAGTAGAAATGGGTACATCAAGTCAGAATGATGTT GACATGAGTTGGATTCCTCAGGAAACATTGAATCAAATCAATAAAGCTTCACCAAGAAGG TTGCCCAGGAAACGGGCACAGAAGAGATCAGTGGGATCTGATGAGTAAATGTTCCTTTGT GCAACAATTCGGTCTTTACTTAACCTGCCCTAATATTTTTCGGCCTGATGGGAATTAGTG CAGAGAAGCCATGTCACCATAGAAGGCAACTCCTACTTGTGTGTGGACTGAGCAATCAGA GTCTGTGGCGATAATATTGCTGAAAATGCACTGCATTCATTTTTCTAAAGTAACAAATTT GGTTTTTTTTTAAACCATTAAAATCTATGTGTGTGCGTGTGTATGTATGTGAGCAGTTGG TCTTACCAGAATCATTGTTGAACTACCTGAAACAAGTCTTTAGAATACTAAAAAAAAAAA AAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_003144 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_003144.2, NP_003135.1 |
RefSeq Size | 3285 bp |
RefSeq ORF | 861 bp |
Locus ID | 6745 |
UniProt ID | P43307 |
Domains | TRAP_alpha |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits, a 34-kD glycoprotein encoded by this gene and a 22-kD glycoprotein. This gene generates several mRNA species as a result of complex alternative polyadenylation. This gene is unusual in that it utilizes arrays of polyA signal sequences that are mostly non-canonical. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202408 | SSR1 (Myc-DDK-tagged)-Human signal sequence receptor, alpha (SSR1) |
CN¥ 2,400.00 |
|
RC202408L1 | Lenti ORF clone of Human signal sequence receptor, alpha (SSR1), Myc-DDK-tagged |
CN¥ 4,800.00 |
|
RC202408L2 | Lenti ORF clone of Human signal sequence receptor, alpha (SSR1), mGFP tagged |
CN¥ 5,890.00 |
|
RC202408L3 | Lenti ORF clone of Human signal sequence receptor, alpha (SSR1), Myc-DDK-tagged |
CN¥ 5,890.00 |
|
RC202408L4 | Lenti ORF clone of Human signal sequence receptor, alpha (SSR1), mGFP tagged |
CN¥ 5,890.00 |
|
RG202408 | SSR1 (tGFP-tagged) - Human signal sequence receptor, alpha (SSR1) |
CN¥ 4,000.00 |
其它TRAP alpha产品