United States
Germany
Japan
United Kingdom
China
MAD3 (MXD3) (NM_031300) Human Untagged Clone
CAT＃: SC319057
MXD3 (untagged)-Human MAX dimerization protein 3 (MXD3), transcript variant 1
CNY 2,400.00
CNY 2,950.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BHLHC13; MAD3; MYX |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_031300.2
GCTTGCTCCGGCCGGCACCCTAGGCCGGCCCGCCGCCAGCTGTCGCCGACATGGAACCCT
TGGCCAGCAACATCCAGGTCCTGCTGCAGGCGGCCGAGTTCCTGGAGCGCCGTGAGAGAG AGGCCGAGCATGGTTATGCGTCCCTGTGCCCGCATCGCAGTCCAGGCCCCATCCACAGGA GGAAGAAGCGACCCCCCCAGGCTCCTGGCGCGCAGGACAGCGGGCGGTCAGTGCACAATG AACTGGAGAAGCGCAGGAGGGCCCAGTTGAAGCGGTGCCTGGAGCGGCTGAAGCAGCAGA TGCCCCTGGGGGCCGACTGTGCCCGGTACACCACGCTGAGCCTGCTGCGCCGTGCCAGGA TGCACATCCAGAAGCTGGAGGATCAGGAGCAGCGGGCCCGACAGCTCAAGGAGAGGCTGC GCAGCAAGCAGCAGAGCCTGCAGCGGCAGCTGGAGCAGCTCCGGGGGCTGGCAGGGGCGG CCGAGCGGGAGCGGCTGCGGGCGGACAGTCTGGACTCCTCAGGCCTCTCCTCTGAGCGCT CAGACTCAGACCAAGAGGAGCTGGAGGTGGATGTGGAGAGCCTGGTGTTTGGGGGTGAGG CCGAGCTGCTGCGGGGCTTCGTCGCCGGCCAGGAGCACAGCTACTCGCACGGCGGCGGCG CCTGGCTATGATGTTCCTCACCCAGGGCGGGCCTCTGCCCTCTACTCGTGCCAGGCCCAC TTGCCAGGCAGGAGCCCTCCCCAAGCCTTCAGGGCTGCTCGGAGTCACCTGTTGGAATGG ACTAAAAGGACCCTTGTGTGGGAACAGGTGCTCCCCAAACACCCTGCTGCTGGCTGCCAG GCAGGCCCTCTGGAAGGGAAGGGGCAGGACTCATCAGGACCTCCCTGGACCCCTGCAGGG CAGGCAGCTTGGGCCCGAGCCCAAGCATTTGGCTCTGCTGCCCCCAAGGGGACAGGAAGC CTCTTGGGCCTCTTCCCTTCCTGGACAAGGCCCCCTGCCTTTGCCTCACATAAACTGTAC AGTATTTTCATTAAAAGCCTCTTTCATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AA |
| Restriction Sites | Please inquire |
| ACCN | NM_031300 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_031300.2, NP_112590.1 |
| RefSeq Size | 1082 bp |
| RefSeq ORF | 621 bp |
| Locus ID | 83463 |
| UniProt ID | Q9BW11 |
| Domains | HLH |
| Protein Families | Druggable Genome, Transcription Factors |
| Gene Summary | This gene encodes a member of the Myc superfamily of basic helix-loop-helix leucine zipper transcriptional regulators. The encoded protein forms a heterodimer with the cofactor MAX which binds specific E-box DNA motifs in the promoters of target genes and regulates their transcription. Disruption of the MAX-MXD3 complex is associated with uncontrolled cell proliferation and tumorigenesis. Transcript variants of this gene encoding different isoforms have been described.[provided by RefSeq, Dec 2008] Transcript Variant: This variant (1) encodes the longer isoform (a). |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Alternative Splicing of MXD3 and Its Regulation of MXD3 Levels in Glioblastoma
,Ngo, T;Corrales, A;Bourne, T;Elmojahid, S;Lam, KS;Díaz, E;,
Front Mol Biosci
,PubMed ID 30838212
[MXD3]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC200747 | MXD3 (Myc-DDK-tagged)-Human MAX dimerization protein 3 (MXD3), transcript variant 1 |
CNY 2,400.00 |
|
| RC200747L3 | Lenti ORF clone of Human MAX dimerization protein 3 (MXD3), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC200747L4 | Lenti ORF clone of Human MAX dimerization protein 3 (MXD3), transcript variant 1, mGFP tagged |
CNY 4,800.00 |
|
| RG200747 | MXD3 (tGFP-tagged) - Human MAX dimerization protein 3 (MXD3), transcript variant 1 |
CNY 4,000.00 |
