United States
Germany
Japan
United Kingdom
China
FBXW8 (NM_153348) Human Untagged Clone
CAT＃: SC318948
FBXW8 (untagged)-Human F-box and WD repeat domain containing 8 (FBXW8), transcript variant 1
CN¥ 6,688.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FBW6; FBW8; FBX29; FBXO29; FBXW6 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_153348, the custom clone sequence may differ by one or more nucleotides
ATGGACGACTACAGCCTGGATGAGTTCCGTCGGCGCTGGCAGGAGGAGCTGGCGCAGGCCCAGGCGCCGA AGAAGCGGCGACGGCCCGAGGCTGCCGAGAGGCGGGCTCGGCGGCCGGAGGTGGGCTCCGGGCGCGGCGA ACAGGCCTCGGGGGACCCGGCGCTGGCCCAGCGTCTCCTGGAGGGCGCGGGGAGGCCCCCGGCGGCGCGG GCGACTCGGGCCGAGGGGCAGGACGTAGCGAGCCGCTCACGTTCTCCTCTGGCCCGCGAGGGCGCCGGGG GCGGGGAGCAGCTGGTGGACCAGCTCATCCGCGACCTGAATGAAATGAATGATGTGCCTTTCTTTGATAT CCAACTGCCTTACGAATTGGCAATCAATATATTTCAGTATCTGGACAGGAAAGAACTAGGAAGATGTGCA CAGGTGAGCAAGACGTGGAAGGTGATTGCAGAGGATGAGGTGCTGTGGTACAGGCTGTGCCAGCAGGAAG GGCACCTTCCGGATAGCAGCATCTCTGACTATTCTTGCTGGAAGCTCATCTTCCAAGAGTGCCGAGCCAA GGAACACATGTTACGAACCAACTGGAAGAATCGCAAAGGTGCCGTGAGCGAGCTGGAGCATGTTCCTGAC ACAGTTTTGTGTGATGTGCATTCTCACGATGGTGTGGTCATTGCGGGATATACATCAGGGGATGTGAGAG TGTGGGACACCCGCACCTGGGACTACGTAGCCCCCTTCCTGGAATCAGAGGACGAGGAGGATGAGCCTGG AATGCAGCCAAATGTCTCCTTTGTGAGGATAAACAGCTCGTTGGCAGTAGCAGCTTATGAGGATGGGTTT CTTAATATTTGGGATTTAAGGACCGGAAAGTACCCTGTTCATCGTTTTGAGCACGATGCAAGAATACAGG CACTAGCCCTCAGCCAGGACGATGCAACCGTGGCCACAGCTTCTGCTTTTGATGTCGTGATGTTATCCCC CAATGAGGAGGGGTACTGGCAGATAGCTGCGGAATTTGAAGTTCCGAAACTGGTTCAGTACCTTGAAATA GTTCCAGAAACCAGAAGGTACCCTGTGGCAGTAGCCGCTGCTGGAGATCTGATGTACCTGCTCAAAGCCG AAGACTCCGCCAGAACCCTCCTTTACGCCCACGGCCCGCCTGTCACATGTCTAGACGTCTCGGCCAACCA AGTTGCTTTTGGTGTACAGGGTCTGGGATGGGTGTACGAAGGAAGCAAGATCCTGGTGTATAGCCTGGAA GCAGGACGCCGCCTCTTGAAGCTGGGTAACGTTCTCCGTGACTTCACGTGTGTCAACCTCAGCGACAGCC CTCCCAACCTCATGGTCAGTGGCAACATGGACGGGAGGGTGAGGATCCACGACCTCCGCAGTGGTAACAT CGCCCTGTCGCTCTCCGCCCATCAGCTCAGGGTCTCTGCTGTGCAGATGGATGACTGGAAGATCGTCAGT GGAGGCGAGGAAGGCCTGGTGTCCGTGTGGGATTATCGGATGAACCAGAAGCTGTGGGAGGTGTATTCCG GGCACCCGGTGCAGCACATCTCATTCAGCAGCCACAGCCTCATCACGGCCAACGTGCCTTACCAGACGGT AATGCGAAACGCCGACCTGGACAGCTTCACTACTCACAGGAGACACCGGGGGCTGATCCGCGCCTATGAG TTTGCGGTGGACCAGCTGGCCTTCCAGAGCCCTCTCCCTGTCTGCCGTTCATCCTGTGACGCCATGGCCA CTCACTACTACGACCTCGCACTGGCCTTTCCCTATAACCATGTTTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_153348 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_153348.2, NP_699179.2 |
| RefSeq Size | 4871 bp |
| RefSeq ORF | 1797 bp |
| Locus ID | 26259 |
| UniProt ID | Q8N3Y1 |
| Protein Families | Druggable Genome |
| Protein Pathways | Ubiquitin mediated proteolysis |
| Gene Summary | This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains a WD-40 domain, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) is the longer transcript and encodes the longer isoform (1). |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
A novel mechanism by which thiazolidinediones facilitate the proteasomal degradation of cyclin D1 in cancer cells
,Shuo Wei, Hsiao-Ching Yang, Hsiao-Ching Chuang, Jian Yang, Samuel K. Kulp, Pei-Jung Lu, Ming-Derg Lai, and Ching-Shih Chen,
J. Biol. Chem. 2008; 283(39): p. 26759-26770
[FBXW8]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC206199 | FBXW8 (Myc-DDK-tagged)-Human F-box and WD repeat domain containing 8 (FBXW8), transcript variant 1 |
CN¥ 6,680.00 |
|
| RC206199L1 | Lenti ORF clone of Human F-box and WD repeat domain containing 8 (FBXW8), transcript variant 1, Myc-DDK-tagged |
CN¥ 9,080.00 |
|
| RC206199L2 | Lenti ORF clone of Human F-box and WD repeat domain containing 8 (FBXW8), transcript variant 1, mGFP tagged |
CN¥ 5,890.00 |
|
| RC206199L3 | Lenti ORF clone of Human F-box and WD repeat domain containing 8 (FBXW8), transcript variant 1, Myc-DDK-tagged |
CN¥ 5,890.00 |
|
| RC206199L4 | Lenti ORF clone of Human F-box and WD repeat domain containing 8 (FBXW8), transcript variant 1, mGFP tagged |
CN¥ 9,080.00 |
|
| RG206199 | FBXW8 (tGFP-tagged) - Human F-box and WD repeat domain containing 8 (FBXW8), transcript variant 1 |
CN¥ 4,370.00 |
