CLIC5 (NM_001114086) Human Untagged Clone

CAT#: SC318862

CLIC5 (untagged)-Human chloride intracellular channel 5 (CLIC5), nuclear gene encoding mitochondrial protein, transcript variant 1



  "NM_001114086" in other vectors (6)

CNY 3,656.00

CNY 6,650.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CLIC5 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DFNB102; DFNB103; MST130; MSTP130
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001114086, the custom clone sequence may differ by one or more nucleotides


ATGAATGACGAAGACTACAGCACCATCTATGACACAATCCAAAATGAGAGGACGTATGAGGTTCCAGACC
AGCCAGAAGAAAATGAAAGTCCCCATTATGATGATGTCCATGAGTACTTAAGGCCAGAAAATGATTTATA
TGCCACTCAGCTGAATACCCATGAGTATGATTTTGTGTCAGTCTATACCATTAAGGGTGAAGAGACCAGC
TTGGCCTCTGTCCAGTCAGAAGACAGAGGCTACCTCCTGCCTGATGAGATATACTCTGAACTCCAGGAGG
CTCATCCAGGTGAGCCCCAGGAGGACAGGGGCATCTCAATGGAAGGGTTATATTCATCAACCCAGGACCA
GCAACTCTGCGCAGCAGAACTCCAGGAGAATGGGAGTGTGATGAAGGAAGATCTGCCTTCTCCTTCAAGC
TTCACCATTCAGCACAGTAAGGCCTTCTCTACCACCAAGTATTCCTGCTATTCTGATGCTGAAGGTTTGG
AAGAAAAGGAGGGAGCTCACATGAACCCTGAGATTTACCTCTTTGTGAAGGCTGGAATCGATGGAGAAAG
CATCGGCAACTGTCCTTTCTCTCAGCGCCTCTTCATGATCCTCTGGCTGAAAGGAGTCGTGTTCAATGTC
ACCACTGTGGATCTGAAAAGAAAGCCAGCTGACCTGCACAACCTAGCCCCCGGCACGCACCCGCCCTTCC
TGACCTTCAACGGGGACGTGAAGACAGACGTCAATAAGATCGAGGAGTTCCTGGAGGAGACCTTGACCCC
TGAAAAGTACCCCAAACTGGCTGCAAAACACCGGGAATCCAACACAGCGGGCATCGACATCTTTTCCAAG
TTTTCTGCCTACATCAAAAATACCAAGCAGCAGAACAATGCTGCTCTTGAAAGAGGCCTAACCAAGGCTC
TAAAGAAATTGGATGACTACCTGAACACCCCTCTACCAGAGGAGATTGACGCCAACACTTGTGGGGAAGA
CAAGGGGTCCCGGCGCAAGTTCCTGGATGGGGATGAGCTGACCCTGGCTGACTGCAATCTGTTGCCCAAG
CTCCATGTGGTCAAGATTGTGGCCAAGAAATACCGCAACTATGATATCCCGGCTGAGATGACAGGCCTGT
GGCGGTACCTCAAGAACGCCTATGCCCGTGATGAGTTCACCAACACCTGTGCAGCTGACAGTGAGATCGA
GTTGGCCTACGCTGATGTCGCCAAACGCCTCAGCCGATCCTGA


Restriction Sites Please inquire     
ACCN NM_001114086
Insert Size 1260 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001114086.1, NP_001107558.1
RefSeq Size 5988 bp
RefSeq ORF 1233 bp
Locus ID 53405
UniProt ID Q9NZA1
Protein Families Druggable Genome, Ion Channels: Other
Gene Summary This gene encodes a member of the chloride intracellular channel (CLIC) family of chloride ion channels. The encoded protein associates with actin-based cytoskeletal structures and may play a role in multiple processes including hair cell stereocilia formation, myoblast proliferation and glomerular podocyte and endothelial cell maintenance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a, also known as also known as CLIC5B).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...