p63 (TP63) (NM_001114982) Human Untagged Clone

CAT#: SC318851

TP63 (untagged)-Human tumor protein p63 (TP63), transcript variant 6



  "NM_001114982" in other vectors (4)

CNY 6,370.00


货期*
2周

规格
    • 10 ug

Product images

经常一起买 (4)
TP63 mouse monoclonal antibody, clone OTI4E7 (formerly 4E7)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AIS; B(p51A); B(p51B); EEC3; KET; LMS; NBP; OFC8; p40; p51; p53CP; p63; p73H; p73L; RHS; SHFM4; TP53CP; TP53L; TP73L
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001114982 edited
CTTGAGTTCTGTTATCTTCTTAAGTAGATTCATATTGTAAGGGTCTCGGGGTGGGGGGGT
TGGCAAAATCCTGGAGCCAGAAGAAAGGACAGCAGCATTGATCAATCTTACAGCTAACAT
GTTGTACCTGGAAAACAATGCCCAGACTCAATTTAGTGAGCCACAGTACACGAACCTGGG
GCTCCTGAACAGCATGGACCAGCAGATTCAGAACGGCTCCTCGTCCACCAGTCCCTATAA
CACAGACCACGCGCAGAACAGCGTCACGGCGCCCTCGCCCTACGCACAGCCCAGCTCCAC
CTTCGATGCTCTCTCTCCATCACCCGCCATCCCCTCCAACACCGACTACCCAGGCCCGCA
CAGTTTCGACGTGTCCTTCCAGCAGTCGAGCACCGCCAAGTCGGCCACCTGGACGTATTC
CACTGAACTGAAGAAACTCTACTGCCAAATTGCAAAGACATGCCCCATCCAGATCAAGGT
GATGACCCCACCTCCTCAGGGAGCTGTTATCCGCGCCATGCCTGTCTACAAAAAAGCTGA
GCACGTCACGGAGGTGGTGAAGCGGTGCCCCAACCATGAGCTGAGCCGTGAATTCAACGA
GGGACAGATTGCCCCTCCTAGTCATTTGATTCGAGTAGAGGGGAACAGCCATGCCCAGTA
TGTAGAAGATCCCATCACAGGAAGACAGAGTGTGCTGGTACCTTATGAGCCACCCCAGGT
TGGCACTGAATTCACGACAGTCTTGTACAATTTCATGTGTAACAGCAGTTGTGTTGGAGG
GATGAACCGCCGTCCAATTTTAATCATTGTTACTCTGGAAACCAGAGATGGGCAAGTCCT
GGGCCGACGCTGCTTTGAGGCCCGGATCTGTGCTTGCCCAGGAAGAGACAGGAAGGCGGA
TGAAGATAGCATCAGAAAGCAGCAAGTTTCGGACAGTACAAAGAACGGTGATGGTACGAA
GCGCCCGTTTCGTCAGAACACACATGGTATCCAGATGACATCCATCAAGAAACGAAGATC
CCCAGATGATGAACTGTTATACTTACCAGTGAGGGGCCGTGAGACTTATGAAATGCTGTT
GAAGATCAAAGAGTCCCTGGAACTCATGCAGTACCTTCCTCAGCACACAATTGAAACGTA
CAGGCAACAGCAACAGCAGCAGCACCAGCACTTACTTCAGAAACATCTCCTTTCAGCCTG
CTTCAGGAATGAGCTTGTGGAGCCCCGGAGAGAAACTCCAAAACAATCTGACGTCTTCTT
TAGACATTCCAAGCCCCCAAACCGATCAGTGTACCCATAGAGCCCTATCTCTATATTTTA
AGTGTGTGTGTTGTATTTCCATGTGTATATGTGAGTGTGTGTGTGTGTATGTGTGTGCGT
GTGTATCTAGCCCTCAT
Restriction Sites Please inquire     
ACCN NM_001114982
Insert Size 1400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001114982.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001114982.1, NP_001108454.1
RefSeq Size 2640 bp
RefSeq ORF 1182 bp
Locus ID 8626
UniProt ID Q9H3D4
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene encodes a member of the p53 family of transcription factors. The functional domains of p53 family proteins include an N-terminal transactivation domain, a central DNA-binding domain and an oligomerization domain. Alternative splicing of this gene and the use of alternative promoters results in multiple transcript variants encoding different isoforms that vary in their functional properties. These isoforms function during skin development and maintenance, adult stem/progenitor cell regulation, heart development and premature aging. Some isoforms have been found to protect the germline by eliminating oocytes or testicular germ cells that have suffered DNA damage. Mutations in this gene are associated with ectodermal dysplasia, and cleft lip/palate syndrome 3 (EEC3); split-hand/foot malformation 4 (SHFM4); ankyloblepharon-ectodermal defects-cleft lip/palate; ADULT syndrome (acro-dermato-ungual-lacrimal-tooth); limb-mammary syndrome; Rap-Hodgkin syndrome (RHS); and orofacial cleft 8. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (6) differs in the 5' UTR and coding region, and in the 3' UTR and coding region, compared to variant 1. The resulting isoform (6, also known as deltaNp63gamma, P51delNgamma, and deltaN-gamma) is shorter and has distinct N- and C-termini, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...