United States
Germany
Japan
United Kingdom
China
Dematin (DMTN) (NM_001114137) Human Untagged Clone
CAT＃: SC318847
EPB49 (untagged)-Human erythrocyte membrane protein band 4.9 (dematin) (EPB49), transcript variant 4
CNY 7,220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DMT; EPB49 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001114137, the custom clone sequence may differ by one or more nucleotides
ATGGAACGGCTGCAGAAGCAACCACTTACCTCCCCCGGGAGCGTGAGCCCCTCCCGAGAT TCCAGTGTGCCTGGCTCTCCCTCCAGCATCGTGGCCAAGATGGACAATCAGGTGCTGGGC TACAAGGACCTGGCTGCCATCCCCAAGGACAAGGCCATCCTGGACATCGAGCGGCCCGAC CTCATGATCTACGAGCCTCACTTCACTTATTCCCTCCTGGAACACGTGGAGCTGCCTCGC AGCCGCGAGCGCTCGCTGTCACCCAAATCCACATCCCCCCCACCATCCCCAGAGGTGTGG GCGGACAGCCGGTCGCCTGGAATCATCTCTCAGGCCTCGGCCCCCAGAACCACTGGAACC CCCCGGACCAGCCTGCCCCATTTCCACCACCCTGAGACCTCCCGCCCAGATTCCAACATC TACAAGAAGCCTCCCATCTATAAGCAGAGAGAGTCCGTGGGAGGCAGCCCTCAGACCAAG CACCTCATCGAGGATCTCATCATCGAGTCATCCAAGTTTCCTGCAGCCCAGCCCCCAGAC CCCAACCAGCCAGCCAAAATCGAAACCGACTACTGGCCATGCCCCCCGTCTCTGGCTGTT GTGGAGACAGAATGGAGGAAGCGGAAGGCGTCTCGGAGGGGAGCAGAGGAAGAGGAGGAG GAGGAAGATGACGACTCTGGAGAGGAGATGAAGGCTCTCAGGGAGCGTCAGAGAGAGGAA CTCAGTAAGGTTACTTCCAACTTGGGAAAGATGATCTTGAAAGAAGAGATGGAAAAGTCA TTGCCGATCCGAAGGAAAACCCGCTCTCTGCCTGACCGGACACCCTTCCATACCTCCTTG CACCAGGGAACGTCTAAATCTTCCTCTCTCCCCGCCTATGGCAGGACCACCCTGAGCCGG CTACAGTCCACAGAGTTCAGCCCATCAGGGAGTGAGACTGGAAGCCCAGGCCTGCAGATC TATCCCTATGAAATGCTAGTGGTGACCAACAAGGGGCGAACCAAGCTGCCACCGGGGGTG GATCGGATGCGGCTTGAGAGGCATCTGTCTGCCGAGGACTTCTCAAGGGTATTTGCCATG TCCCCTGAAGAGTTTGGCAAGCTGGCTCTGTGGAAGCGGAATGAGCTCAAGAAGAAGGCC TCTCTCTTC |
| Restriction Sites | Please inquire |
| ACCN | NM_001114137 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001114137.1, NP_001107609.1 |
| RefSeq Size | 2654 bp |
| RefSeq ORF | 1152 bp |
| Locus ID | 2039 |
| UniProt ID | Q08495 |
| Gene Summary | The protein encoded by this gene is an actin binding and bundling protein that plays a structural role in erythrocytes, by stabilizing and attaching the spectrin/actin cytoskeleton to the erythrocyte membrane in a phosphorylation-dependent manner. This protein contains a core domain in the N-terminus, and a headpiece domain in the C-terminus that binds F-actin. When purified from erythrocytes, this protein exists as a trimer composed of two 48 kDa polypeptides and a 52 kDa polypeptide. The different subunits arise from alternative splicing in the 3' coding region, where the headpiece domain is located. Disruption of this gene has been correlated with the autosomal dominant Marie Unna hereditary hypotrichosis disease, while loss of heterozygosity of this gene is thought to play a role in prostate cancer progression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (4) contains an alternate exon in the 5' UTR and lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. Variants 4, 5, 7, 14, 15 and 16 encode the same isoform (2, also known as the 48 kDa subunit, PMID:7615546), which is shorter than isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225585 | EPB49 (Myc-DDK-tagged)-Human erythrocyte membrane protein band 4.9 (dematin) (EPB49), transcript variant 4 |
CNY 3,990.00 |
|
| RC225585L3 | Lenti-ORF clone of EPB49 (Myc-DDK-tagged)-Human erythrocyte membrane protein band 4.9 (dematin) (EPB49), transcript variant 4 |
CNY 5,890.00 |
|
| RC225585L4 | Lenti-ORF clone of EPB49 (mGFP-tagged)-Human erythrocyte membrane protein band 4.9 (dematin) (EPB49), transcript variant 4 |
CNY 5,890.00 |
|
| RG225585 | EPB49 (tGFP-tagged) - Human erythrocyte membrane protein band 4.9 (dematin) (EPB49), transcript variant 4 |
CNY 4,370.00 |
其它Dematin产品
