United States
Germany
Japan
United Kingdom
China
ALP (PDLIM3) (NM_001114107) Human Untagged Clone
CAT＃: SC318828
PDLIM3 (untagged)-Human PDZ and LIM domain 3 (PDLIM3), transcript variant 2
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ALP |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001114107, the custom clone sequence may differ by one or more nucleotides
ATGCCCCAGACGGTGATCCTCCCGGGCCCTGCGCCCTGGGGCTTCAGGCTCTCAGGGGGC ATAGACTTCAACCAGCCTTTGGTCATCACCAGGATTACACCAGGAAGCAAGGCGGCAGCT GCCAACCTGTGTCCTGGAGATGTCATCCTGGCTATTGACGGCTTTGGGACAGAGTCCATG ACTCATGCTGATGCGCAGGACAGGATTAAAGCAGCAGCTCACCAGCTGTGTCTCAAAATT GACAGGGGAGAAACTCACTTATGGTCTCCACAAGTATCTGAAGATGGGAAAGCCCATCCT TTCAAAATCAACTTAGAATCAGAACCACAGGAATTCAAACCCATTGGTACCGCGCACAAC AGAAGGGCCCAGCCTTTTGTTGCAGCTGCAAACATTGATGACAAAAGACAGGTAGTGAGC GCTTCCTATAACTCGCCAATTGGGCTCTATTCAACTAGCAATATACAAGATGCGCTTCAC GGACAGCTGCGGGGTCTCATTCCTAGCTCACCTCAAAACGAGCCCACAGCCTCGGTGCCC CCCGAGTCGGACGTGTACCGGATGCTCCACGACAATCGGAATGAGCCCACACAGCCTCGC CAGTCGGGCTCCTTCAGAGTGCTCCAGGGAATGGTGGACGATGGCTCTGATGACCGTCCG GCTGGAACGCGGAGTGTGAGAGCTCCGGTGACGAAAGTCCATGGCGGTTCAGGCGGGGCA CAGAGGATGCCGCTCTGTGACAAATGTGGGAGTGGCATAGTCGGTGCTGTGGTGAAGGCG CGGGATAAGTACCGGCACCCTGAGTGCTTCGTGTGTGCCGACTGCAACCTCAACCTCAAG CAAAAGGGCTACTTCTTCATAGAAGGGGAGCTGTACTGCGAAACCCACGCAAGAGCCCGC ACAAAGCCCCCAGAGGGCTATGACACGGTCACTCTGTATCCCAAAGCT |
| Restriction Sites | Please inquire |
| ACCN | NM_001114107 |
| Insert Size | 2709 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001114107.1, NP_001107579.1 |
| RefSeq Size | 2709 bp |
| RefSeq ORF | 2709 bp |
| Locus ID | 27295 |
| UniProt ID | Q53GG5 |
| Gene Summary | The protein encoded by this gene contains a PDZ domain and a LIM domain, indicating that it may be involved in cytoskeletal assembly. In support of this, the encoded protein has been shown to bind the spectrin-like repeats of alpha-actinin-2 and to colocalize with alpha-actinin-2 at the Z lines of skeletal muscle. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Aberrant alternative splicing of this gene may play a role in myotonic dystrophy. [provided by RefSeq, Apr 2012] Transcript Variant: This variant (2) lacks two consecutive exons in the coding region and contains an alternate coding exon, but maintains the reading frame, compared to variant 1. The encoded isoform (b) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225454 | PDLIM3 (Myc-DDK-tagged)-Human PDZ and LIM domain 3 (PDLIM3), transcript variant 2 |
CNY 3,990.00 |
|
| RC225454L3 | Lenti-ORF clone of PDLIM3 (Myc-DDK-tagged)-Human PDZ and LIM domain 3 (PDLIM3), transcript variant 2 |
CNY 5,890.00 |
|
| RC225454L4 | Lenti-ORF clone of PDLIM3 (mGFP-tagged)-Human PDZ and LIM domain 3 (PDLIM3), transcript variant 2 |
CNY 5,890.00 |
|
| RG225454 | PDLIM3 (tGFP-tagged) - Human PDZ and LIM domain 3 (PDLIM3), transcript variant 2 |
CNY 4,370.00 |
