Trypsin (PRSS3) (NM_007343) Human Untagged Clone

CAT#: SC318823

PRSS3 (untagged)-Human protease, serine, 3 (PRSS3), transcript variant 1



  "NM_007343" in other vectors (4)

CNY 2,400.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal Anti-PRSS3 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MTG; PRSS4; T9; TRY3; TRY4
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_007343 edited
CCTCTCCTGAAGCACACAGCCTAGGGAGTTCCTGGGGCCAGAGACATCTCCAAGGGAAGG
TCAAGGGCCTGGAGGATGTGCGGACCTGACGACAGATGCCCCGCACGCTGGCCGGGACCG
GGAAGGGCGGTCAAGTGTGGAAAGGGTCTGGCGGCTGCCAGGCCTGGCAGAGTGGAGCGG
GGCGGGGCGCAGCGGGGCGGGGCGGGCCTGGAGCTGCACCCGCTTCTGGGTGGACGCACT
TGGCGAGCGGCGCGGGATGCAGACGGCTGCGAGGCGCTGGGCACAGTTGCTGTCCCCTTT
GACGATGATGACAAGATTGTTGGGGGCTACACCTGTGAGGAGAATTCTCTCCCCTACCAG
GTGTCCCTGAATTCTGGCTCCCACTTCTGCGGTGGCTCCCTCATCAGCGAACAGTGGGTG
GTATCAGCAGCTCACTGCTACAAGACCCGCATCCAGGTGAGACTGGGAGAGCACAACATC
AAAGTCCTGGAGGGGAATGAGCAGTTCATCAATGCGGCCAAGATCATCCGCCACCCTAAA
TACAACAGGGACACTCTGGACAATGACATCATGCTGATCAAACTCTCCTCACCTGCCGTC
ATCAATGCCCGCGTGTCCACCATCTCTCTGCCCACCGCCCCTCCAGCTGCTGGCACTGAG
TGCCTCATCTCCGGCTGGGGCAACACTCTGAGCTTTGGTGCTGACTACCCAGACGAGCTG
AAGTGCCTGGATGCTCCGGTGCTGACCCAGGCTGAGTGTAAAGCCTCCTACCCTGGAAAG
ATTACCAACAGCATGTTCTGTGTGGGCTTCCTTGAGGGAGGCAAGGATTCCTGCCAGCGT
GACTCTGGTGGCCCTGTGGTCTGCAACGGACAGCTCCAAGGAGTTGTCTCCTGGGGCCAT
GGCTGTGCCTGGAAGAACAGGCCTGGAGTCTACACCAAGGTCTACAACTATGTGGACTGG
ATTAAGGACACCATCGCTGCCAACAGCTAA
Restriction Sites Please inquire     
ACCN NM_007343
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_007343.2, NP_031369.2
RefSeq Size 981 bp
RefSeq ORF 915 bp
Locus ID 5646
UniProt ID P35030
Protein Families Druggable Genome, Protease, Secreted Protein
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary This gene encodes a trypsinogen, which is a member of the trypsin family of serine proteases. This enzyme is expressed in the brain and pancreas and is resistant to common trypsin inhibitors. It is active on peptide linkages involving the carboxyl group of lysine or arginine. This gene is localized to the locus of T cell receptor beta variable orphans on chromosome 9. Four transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2010]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...