FCAMR (NM_001122979) Human Untagged Clone
CAT#: SC318812
FCAMR (untagged)-Human Fc receptor, IgA, IgM, high affinity (FCAMR), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD351; FCA/MR; FKSG87 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC318812 representing NM_001122979.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGATGGAGAGGCCACAGTGAAGCCTGGAGAACAAAAGGAAGTGGTGAGGAGAGGAAGAGAAGTGGAC TACTCCAGGCTCATTGCTGGCACTTTACCACAATCTCACGTCACCAGCAGGAGGGCGGGATGGAAAATG CCCCTCTTCCTCATACTGTGCCTGCTACAAGGTTCTTCTTTCGCCCTTCCACAAAAAAGACCCCATCCG AGATGGCTGTGGGAGGGCTCTCTCCCCTCCAGGACCCATCTCCGGGCCATGGGAACACTCAGGCCTTCC TCGCCCCTCTGCTGGCGGGAGGAGAGCTCCTTTGCAGCTCCAAATTCATTGAAGGGCTCAAGGCTGGTG TCAGGGGAGCCTGGAGGAGCTGTCACCATCCAGTGCCATTATGCCCCCTCATCTGTCAACAGGCACCAG AGGAAGTACTGGTGCCGTCTGGGGCCCCCAAGATGGATCTGCCAGACCATTGTGTCCACCAACCAGTAT ACTCACCATCGCTATCGTGACCGTGTGGCCCTCACAGACTTTCCACAGAGAGGCTTGTTTGTGGTGAGG CTGTCCCAACTGTCCCCGGATGACATCGGATGCTACCTCTGCGGCATTGGAAGTGAAAACAACATGCTG TTCTTAAGCATGAATCTGACCATCTCTGCAGTACTTTTCCAGAAGATGAAAGCAGCTCTCGGACCCTGG CTCCTGTCTCTACCATGCTGGCCCTGTTTATGCTTATGGCTCTGGTTCTATTGCAAAGGAAGCTCTGGA GAAGGAGGACCTCTCAGGAGGCAGAAAGGGTCACCTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001122979 |
Insert Size | 798 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001122979.2 |
RefSeq Size | 1898 bp |
RefSeq ORF | 798 bp |
Locus ID | 83953 |
UniProt ID | Q8WWV6 |
Protein Families | Druggable Genome, Transmembrane |
MW | 29.9 kDa |
Gene Summary | Functions as a receptor for the Fc fragment of IgA and IgM. Binds IgA and IgM with high affinity and mediates their endocytosis. May function in the immune response to microbes mediated by IgA and IgM.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR and lacks an alternate exon in the 3' coding region resulting in a frameshift, compared to variant 3. The resulting isoform (a) has a shorter and distinct C-terminus, compared to isoform b. Both variants 1 and 2 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225359 | FCAMR (Myc-DDK-tagged)-Human Fc receptor, IgA, IgM, high affinity (FCAMR), transcript variant 2 |
CNY 2,400.00 |
|
RC225359L3 | Lenti ORF clone of Human Fc receptor, IgA, IgM, high affinity (FCAMR), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225359L4 | Lenti ORF clone of Human Fc receptor, IgA, IgM, high affinity (FCAMR), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG225359 | FCAMR (tGFP-tagged) - Human Fc receptor, IgA, IgM, high affinity (FCAMR), transcript variant 2 |
CNY 4,370.00 |