FOLR2 (NM_001113535) Human Untagged Clone
CAT#: SC318809
FOLR2 (untagged)-Human folate receptor 2 (fetal) (FOLR2), transcript variant 3
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BETA-HFR; FBP; FBP/PL-1; FOLR1; FR-BETA; FR-P3; FRbeta |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001113535, the custom clone sequence may differ by one or more nucleotides
ATGGTCTGGAAATGGATGCCACTTCTGCTGCTTCTGGTCTGTGTAGCCACCATGTGCAGT GCCCAGGACAGGACTGATCTCCTCAATGTCTGTATGGATGCCAAGCACCACAAGACAAAG CCAGGTCCTGAGGACAAGCTGCATGACCAATGCAGTCCCTGGAAGAAGAATGCCTGCTGC ACAGCCAGCACCAGCCAGGAGCTGCACAAGGACACCTCCCGCCTGTACAACTTTAACTGG GACCACTGCGGCAAGATGGAGCCCGCCTGCAAGCGCCACTTCATCCAGGACACCTGTCTC TATGAGTGCTCACCCAACCTGGGGCCCTGGATCCAGCAGGTGAATCAGAGCTGGCGCAAA GAACGCTTCCTGGATGTGCCCTTATGCAAAGAGGACTGTCAGCGCTGGTGGGAGGATTGT CACACCTCCCACACGTGCAAGAGCAACTGGCACAGAGGATGGGACTGGACCTCAGGAGTT AACAAGTGCCCAGCTGGGGCTCTCTGCCGCACCTTTGAGTCCTACTTCCCCACTCCAGCT GCCCTTTGTGAAGGCCTCTGGAGTCACTCATACAAGGTCAGCAACTACAGCCGAGGGAGC GGCCGCTGCATCCAGATGTGGTTTGATTCAGCCCAGGGCAACCCCAACGAGGAAGTGGCG AGGTTCTATGCTGCAGCCATGCATGTGAATGCTGGTGAGATGCTTCATGGGACTGGGGGT CTCCTGCTCAGTCTGGCCCTGATGCTGCAACTCTGGCTCCTTGGC |
Restriction Sites | Please inquire |
ACCN | NM_001113535 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001113535.1, NP_001107007.1 |
RefSeq Size | 1133 bp |
RefSeq ORF | 768 bp |
Locus ID | 2350 |
UniProt ID | P14207 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | The protein encoded by this gene is a member of the folate receptor (FOLR) family, and these genes exist in a cluster on chromosome 11. Members of this gene family have a high affinity for folic acid and for several reduced folic acid derivatives, and they mediate delivery of 5-methyltetrahydrofolate to the interior of cells. This protein has a 68% and 79% sequence homology with the FOLR1 and FOLR3 proteins, respectively. Although this protein was originally thought to be specific to placenta, it can also exist in other tissues, and it may play a role in the transport of methotrexate in synovial macrophages in rheumatoid arthritis patients. Multiple transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. All variants (1-4) encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225339 | FOLR2 (Myc-DDK-tagged)-Human folate receptor 2 (fetal) (FOLR2), transcript variant 3 |
CNY 2,400.00 |
|
RC225339L3 | Lenti-ORF clone of FOLR2 (Myc-DDK-tagged)-Human folate receptor 2 (fetal) (FOLR2), transcript variant 3 |
CNY 5,890.00 |
|
RC225339L4 | Lenti-ORF clone of FOLR2 (mGFP-tagged)-Human folate receptor 2 (fetal) (FOLR2), transcript variant 3 |
CNY 5,890.00 |
|
RG225339 | FOLR2 (tGFP-tagged) - Human folate receptor 2 (fetal) (FOLR2), transcript variant 3 |
CNY 4,370.00 |