CD99 (NM_001122898) Human Untagged Clone
CAT#: SC318787
CD99 (untagged)-Human CD99 molecule (CD99), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HBA71; MIC2; MIC2X; MIC2Y; MSK5X |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC318787 representing NM_001122898.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCCGCGGGGCTGCGCTGGCGCTGCTGCTCTTCGGCCTGCTGGGTGTTCTGGTCGCCGCCCCGGAT GGTGGTTTCGATTTATCCGATGCCCTTCCTGGGGATGACTTTGACTTAGGAGATGCTGTTGTTGATGGA GAAAATGACGACCCACGACCACCGAACCCACCCAAACCGATGCCAAATCCAAACCCCAACCACCCTAGT TCCTCCGGTAGCTTTTCAGATGCTGACCTTGCGGATGGCGTTTCAGGTGGAGAAGGAAAAGGAGGCAGT GATGGTGGAGGCAGCCACAGGAAAGAAGGGGAAGAGGCCGACGCCCCAGGCGTGATCCCCGGGATTGTG GGGGCTGTCGTGGTCGCCGTGGCTGGAGCCATCTCTAGCTTCATTGCTTACCAGAAAAAGAAGCTATGC TTCAAAGAAAATGCAGAACAAGGGGAGGTGGACATGGAGAGCCACCGGAATGCCAACGCAGAGCCAGCT GTTCAGCGTACTCTTTTAGAGAAATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001122898 |
Insert Size | 510 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001122898.2 |
RefSeq Size | 1261 bp |
RefSeq ORF | 510 bp |
Locus ID | 4267 |
UniProt ID | P14209 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cell adhesion molecules (CAMs), Leukocyte transendothelial migration |
MW | 17.1 kDa |
Gene Summary | The protein encoded by this gene is a cell surface glycoprotein involved in leukocyte migration, T-cell adhesion, ganglioside GM1 and transmembrane protein transport, and T-cell death by a caspase-independent pathway. In addition, the encoded protein may have the ability to rearrange the actin cytoskeleton and may also act as an oncosuppressor in osteosarcoma. This gene is found in the pseudoautosomal region of chromosomes X and Y and escapes X-chromosome inactivation. There is a related pseudogene located immediately adjacent to this locus. [provided by RefSeq, Mar 2016] Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) is shorter compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225164 | CD99 (Myc-DDK-tagged)-Human CD99 molecule (CD99), transcript variant 2 |
CNY 2,400.00 |
|
RC225164L1 | Lenti ORF clone of Human CD99 molecule (CD99), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC225164L2 | Lenti ORF clone of Human CD99 molecule (CD99), transcript variant 2, mGFP tagged |
CNY 4,800.00 |
|
RC225164L3 | Lenti ORF clone of Human CD99 molecule (CD99), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225164L4 | Lenti ORF clone of Human CD99 molecule (CD99), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG225164 | CD99 (tGFP-tagged) - Human CD99 molecule (CD99), transcript variant 2 |
CNY 4,370.00 |