HIP2 (UBE2K) (NM_001111112) Human Untagged Clone
CAT#: SC318780
UBE2K (untagged)-Human ubiquitin-conjugating enzyme E2K (UBE2K), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | E2-25K; HIP2; HYPG; LIG; UBC1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001111112, the custom clone sequence may differ by one or more nucleotides
ATGGCCAACATCGCGGTGCAGCGAATCAAGCGGGAGTTCAAGGAGGTGCTGAAGAGCGAG GAGACGAGCAAAAATCAAATTAAAGTAGATCTTGTAGATGAGAATTTTACAGAATTAAGA GGAGAAATAGCAGGACCTCCAGACACACCATATGAAGGAGGAAGATACCAACTAGAGATA AAAATACCAGAAACATACCCATTTAATCCCCCTAAGGTCCGGTTTATCACTAAAATATGG CATCCTAATATTAGTTCCGTCACAGGGGCTATTTGTTTGGATATCCTGAAAGATCAATGG GCAGCTGCAATGACTCTCCGCACGGTATTATTGTCATTGCAAGCACTATTGGCAGCTGCA GAGCCAGATGATCCACAGGATGCTGTAGTAGCAAATCAGAATGCAGTAATAGTGGCCTTG TCTTCAAAATCATGGGATGTAGAGACTGCAACAGAATTGCTTCTGAGTAAC |
Restriction Sites | Please inquire |
ACCN | NM_001111112 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001111112.1, NP_001104582.1 |
RefSeq Size | 5130 bp |
RefSeq ORF | 474 bp |
Locus ID | 3093 |
UniProt ID | P61086 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Ubiquitin mediated proteolysis |
Gene Summary | The protein encoded by this gene belongs to the ubiquitin-conjugating enzyme family. This protein interacts with RING finger proteins, and it can ubiquitinate huntingtin, the gene product for Huntington's disease. Known functions for this protein include a role in aggregate formation of expanded polyglutamine proteins and the suppression of apoptosis in polyglutamine diseases, a role in the dislocation of newly synthesized MHC class I heavy chains from the endoplasmic reticulum, and involvement in foam cell formation. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225143 | UBE2K (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2K (UBE2K), transcript variant 2 |
CNY 3,990.00 |
|
RC225143L3 | Lenti-ORF clone of UBE2K (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2K (UBE2K), transcript variant 2 |
CNY 5,890.00 |
|
RC225143L4 | Lenti-ORF clone of UBE2K (mGFP-tagged)-Human ubiquitin-conjugating enzyme E2K (UBE2K), transcript variant 2 |
CNY 5,890.00 |
|
RG225143 | UBE2K (tGFP-tagged) - Human ubiquitin-conjugating enzyme E2K (UBE2K), transcript variant 2 |
CNY 4,370.00 |