United States
Germany
Japan
United Kingdom
China
RGS4 (NM_001113381) Human Untagged Clone
CAT＃: SC318759
RGS4 (untagged)-Human regulator of G-protein signaling 4 (RGS4), transcript variant 4
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | RGP4; SCZD9 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001113381, the custom clone sequence may differ by one or more nucleotides
ATGTGCAAAGGGCTTGCAGGTCTGCCGGCTTCTTGCTTGAGGAGTGCAAAAGATATGAAA CATCGGCTAGGTTTCCTGCTGCAAAAATCTGATTCCTGTGAACACAATTCTTCCCACAAC AAGAAGGACAAAGTGGTTATTTGCCAGAGAGTGAGCCAAGAGGAAGTCAAGAAATGGGCT GAATCACTGGAAAACCTGATTAGTCATGAATGTGAACCTGGATTCTTGCACCAGGGAAGA GACAAGCCGGAACATGCTAGAGCCTACAATAACCTGCTT |
| Restriction Sites | Please inquire |
| ACCN | NM_001113381 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001113381.1, NP_001106852.1 |
| RefSeq Size | 2924 bp |
| RefSeq ORF | 282 bp |
| Locus ID | 5999 |
| UniProt ID | P49798 |
| Protein Families | Druggable Genome |
| Gene Summary | Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 4 belongs to this family. All RGS proteins share a conserved 120-amino acid sequence termed the RGS domain. Regulator of G protein signaling 4 protein is 37% identical to RGS1 and 97% identical to rat Rgs4. This protein negatively regulate signaling upstream or at the level of the heterotrimeric G protein and is localized in the cytoplasm. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) has an alternate 5' sequence, which results in a downstream AUG start codon, and lacks an internal coding exon in the 3' region, as compared to variant 1. The resulting isoform (4) has a shorter N-terminus, and a shorter and distinct C-terminus, as compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225010 | RGS4 (Myc-DDK-tagged)-Human regulator of G-protein signaling 4 (RGS4), transcript variant 4 |
CNY 3,990.00 |
|
| RC225010L3 | Lenti-ORF clone of RGS4 (Myc-DDK-tagged)-Human regulator of G-protein signaling 4 (RGS4), transcript variant 4 |
CNY 5,890.00 |
|
| RC225010L4 | Lenti-ORF clone of RGS4 (mGFP-tagged)-Human regulator of G-protein signaling 4 (RGS4), transcript variant 4 |
CNY 5,890.00 |
|
| RG225010 | RGS4 (tGFP-tagged) - Human regulator of G-protein signaling 4 (RGS4), transcript variant 4 |
CNY 4,370.00 |
