KCNA3 (NM_002232) Human Untagged Clone

CAT#: SC317985

KCNA3 (untagged)-Human potassium voltage-gated channel, shaker-related subfamily, member 3 (KCNA3)



  "NM_002232" in other vectors (7)

CN¥ 6,432.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
Rabbit Polyclonal Anti-KV1.3 (extracellular)
    • 50 ul

CN¥ 11,000.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HGK5; HLK3; HPCN3; HUKIII; KV1.3; MK3; PCN3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_002232, the custom clone sequence may differ by one or more nucleotides


ATGGACGAGCGCCTCAGCCTTCTGCGCTCGCCGCCGCCGCCCTCAGCCCGCCACCGCGCCCACCCTCCTC
AGCGCCCAGCGAGCAGCGGCGGTGCCCACACGCTGGTGAACCACGGCTACGCGGAGCCCGCCGCAGGCCG
CGAGCTGCCGCCCGACATGACCGTGGTGCCCGGGGACCACCTGCTGGAGCCGGAGGTGGCCGATGGTGGA
GGGGCCCCGCCTCAAGGCGGCTGTGGCGGCGGCGGCTGCGACCGCTACGAGCCGCTGCCGCCCTCACTGC
CGGCCGCGGGCGAGCAGGACTGCTGCGGGGAGCGCGTGGTCATCAACATCTCCGGGCTGCGCTTCGAGAC
GCAGCTGAAGACCCTTTGCCAGTTCCCCGAGACGCTGCTGGGCGACCCCAAGCGGCGCATGAGGTACTTC
GACCCGCTCCGCAACGAGTACTTCTTCGACCGCAACCGGCCCAGCTTCGACGCCATCCTCTACTACTATC
AGTCCGGGGGCCGCATCCGCCGGCCGGTCAACGTGCCCATCGACATTTTCTCCGAGGAGATCCGCTTCTA
CCAGCTGGGCGAGGAGGCCATGGAGAAGTTCCGCGAGGACGAGGGCTTCCTGCGGGAGGAGGAGCGGCCC
TTGCCCCGCCGCGACTTCCAGCGCCAGGTGTGGCTGCTCTTCGAGTACCCCGAGAGCTCCGGGCCGGCCC
GGGGCATCGCCATCGTGTCCGTGCTGGTCATCCTCATCTCCATTGTCATCTTCTGCCTGGAGACGCTGCC
GGAGTTCCGCGACGAGAAGGACTACCCCGCCTCGACGTCGCAGGACTCATTCGAAGCAGCCGGCAACAGC
ACGTCGGGGTCCCGCGCAGGAGCCTCCAGCTTCTCCGATCCCTTCTTCGTGGTGGAGACGCTGTGCATCA
TCTGGTTCTCCTTCGAACTGCTGGTGCGGTTCTTCGCTTGTCCTAGCAAAGCCACCTTCTCGCGAAACAT
CATGAACCTGATCGACATTGTGGCCATCATTCCTTATTTTATCACTCTGGGTACCGAGCTGGCCGAACGA
CAGGGCAATGGACAGCAGGCCATGTCTCTGGCCATCCTGAGGGTCATCCGCCTGGTAAGGGTCTTCCGCA
TCTTCAAGCTGTCGCGCCACTCCAAGGGGCTGCAGATCCTCGGGCAAACGCTGAAGGCGTCCATGCGGGA
GCTGGGATTGCTCATCTTCTTCCTCTTTATTGGGGTCATCCTTTTCTCCAGCGCGGTCTACTTTGCCGAG
GCAGACGACCCCACTTCAGGTTTCAGCAGCATCCCGGATGCCTTCTGGTGGGCAGTGGTAACCATGACAA
CAGTGGGTTACGGCGATATGCACCCAGTGACCATAGGGGGCAAGATTGTGGGATCTCTCTGTGCCATCGC
CGGTGTCTTGACCATCGCATTGCCAGTTCCCGTGATTGTTTCCAACTTCAATTACTTCTACCACCGGGAG
ACAGAAGGGGAAGAGCAATCCCAGTACATGCACGTGGGAAGTTGCCAGCACCTCTCCTCTTCAGCCGAGG
AGCTCCGAAAAGCAAGGAGTAACTCGACTCTGAGTAAGTCGGAGTATATGGTGATCGAAGAGGGGGGTAT
GAACCATAGCGCTTTCCCCCAGACCCCTTTCAAAACGGGCAATTCCACTGCCACCTGCACCACGAACAAT
AATCCCAACTCTTGTGTCAACATCAAAAAGATATTCACCGATGTTTAA


Restriction Sites Please inquire     
ACCN NM_002232
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002232.3, NP_002223.3
RefSeq Size 3346 bp
RefSeq ORF 1728 bp
Locus ID 3738
UniProt ID P22001
Domains BTB, K_tetra, ion_trans
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Gene Summary Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. It plays an essential role in T-cell proliferation and activation. This gene appears to be intronless and it is clustered together with KCNA2 and KCNA10 genes on chromosome 1. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the functional protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...