United States
Germany
Japan
United Kingdom
China
GIMAP6 (NM_024711) Human Untagged Clone
CAT＃: SC317425
GIMAP6 (untagged)-Human GTPase, IMAP family member 6 (GIMAP6), transcript variant 1
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | IAN-2; IAN-6; IAN2; IAN6 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_024711, the custom clone sequence may differ by one or more nucleotides
ATGGAGGAAGAAGAATATGAACAAATTCCCCAGGAGAATCCCCCAGAAGAGCTGTCCCAG GATCCTGTGCTGGAGCTGTCAGGAGGTCTAAGGGAGAAAGAACAGAAGACCCCAAGGAGA CTGAGGCTCATTCTCATGGGGAAAACAGGGAGTGGGAAGAGTGCAACAGGAAACAGCATC CTCGGCAGGGACGTCTTCGAGTCTAAACTCAGCACCAGACCCGTGACCAAGACCTCCCAG AGACGGAGCCGAGAGTGGGCTGGGAAGGAGCTTGAGGTGATTGACACACCCAACATTCTG TCCCCCCAGGTCTCGCCAGAGGTGGCAGACGCTATCTGCCAAGCCATCGTCTTATCCGCC CCAGGGCCCCACGCCGTGCTCCTGGTGACACAACTGGGCCGGTTCACGGATGAGGATCAG CAGGTGGTCAGGCGCCTGCAGGAGGTCTTTGGAGTGGGGGTTCTGGGTCACACCATCCTG GTGTTCACCCGGAAGGAAGACCTGGCTGGCGGCTCCCTGGAAGACTATGTGCGAGAGACC AACAACCAGGCCCTTGCCTGGCTGGATGTGACCCTTGCACGGCGCCATTGCGGCTTCAAC AACAGGGCACAGGGGGAGGAGCAGGAGGCCCAACTGCGAGAGCTCATGGAGAAAGTTGAA GCCATTATGTGGGAAAACGAAGGAGATTATTACAGCAACAAGGCTTACCAATATACCCAG CAAAACTTTCGGCTGAAAGAACTACAGGAAAGGCAAGTAAGCCAGGGCCAAGGCTCTGAG GACGTGCCTGGTGAGGAGTCTTGGCTGGAAGGACTGTCCCAGATCCAGAAGGAATCTGAG GAAGCCCACAGATGCCTGCTGGGGAAGGCTGACCTT |
| Restriction Sites | Please inquire |
| ACCN | NM_024711 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_024711.3, NP_078987.3 |
| RefSeq Size | 3422 bp |
| RefSeq ORF | 879 bp |
| Locus ID | 474344 |
| UniProt ID | Q6P9H5 |
| Domains | AIG1 |
| Gene Summary | This gene encodes a member of the GTPases of immunity-associated proteins (GIMAP) family. GIMAP proteins contain GTP-binding and coiled-coil motifs, and may play roles in the regulation of cell survival. Decreased expression of this gene may play a role in non-small cell lung cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, which is found in a cluster with seven additional GIMAP genes on the long arm of chromosome 7. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (1) encodes isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC209164 | GIMAP6 (Myc-DDK-tagged)-Human GTPase, IMAP family member 6 (GIMAP6), transcript variant 1 |
CNY 2,400.00 |
|
| RC209164L3 | Lenti-ORF clone of GIMAP6 (Myc-DDK-tagged)-Human GTPase, IMAP family member 6 (GIMAP6), transcript variant 1 |
CNY 5,890.00 |
|
| RC209164L4 | Lenti-ORF clone of GIMAP6 (mGFP-tagged)-Human GTPase, IMAP family member 6 (GIMAP6), transcript variant 1 |
CNY 5,890.00 |
|
| RG209164 | GIMAP6 (tGFP-tagged) - Human GTPase, IMAP family member 6 (GIMAP6), transcript variant 1 |
CNY 4,370.00 |
|
| SC112090 | GIMAP6 (untagged)-Human GTPase, IMAP family member 6 (GIMAP6), transcript variant 1 |
CNY 2,400.00 |
