PLA2G2F (NM_022819) Human Untagged Clone
CAT#: SC317316
PLA2G2F (untagged)-Human phospholipase A2, group IIF (PLA2G2F)
CNY 3,990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GIIFsPLA2; sPLA2-IIF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317316 representing NM_022819.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCAGATGGGGCAAAGGCCAACCCCAAAGGGTTCAAAAAGAAGGTGCTGGATAGATGCTTCTCTGGG TGGAGGGGCCCACGCTTCGGGGCCTCCTGTCCTTCAAGAACCTCCAGGTCTAGCCTGGGTATGAAGAAG TTCTTCACCGTGGCCATCCTTGCTGGCAGCGTTCTGTCCACAGCTCACGGCAGCCTGCTCAACCTGAAG GCCATGGTGGAGGCCGTCACAGGGAGGAGCGCCATCCTGTCCTTCGTGGGCTACGGTTGCTACTGTGGG CTGGGGGGCCGTGGCCAGCCCAAGGATGAGGTGGACTGGTGCTGCCACGCCCACGACTGCTGCTACCAG GAACTCTTTGACCAAGGCTGTCACCCCTATGTGGACCACTATGATCACACCATCGAGAACAACACTGAG ATAGTCTGCAGTGACCTCAACAAGACAGAGTGTGACAAGCAGACATGCATGTGTGACAAGAACATGGTT CTGTGCCTCATGAACCAGACGTACCGAGAGGAGTACCGTGGCTTCCTCAATGTCTACTGCCAGGGCCCC ACGCCCAACTGCAGCATCTATGAACCGCCCCCTGAGGAGGTCACCTGCAGTCACCAATCCCCAGCGCCC CCCGCCCCTCCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_022819 |
Insert Size | 636 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_022819.3 |
RefSeq Size | 2737 bp |
RefSeq ORF | 636 bp |
Locus ID | 64600 |
UniProt ID | Q9BZM2 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | alpha-Linolenic acid metabolism, Arachidonic acid metabolism, Ether lipid metabolism, Fc epsilon RI signaling pathway, Glycerophospholipid metabolism, GnRH signaling pathway, Linoleic acid metabolism, Long-term depression, MAPK signaling pathway, Metabolic pathways, Vascular smooth muscle contraction, VEGF signaling pathway |
MW | 23.3 kDa |
Gene Summary | May play a role in lipid mediator production in inflammatory conditions, by providing arachidonic acid to downstream cyclooxygenases and lipoxygenases (By similarity). Phospholipase A2, which catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides (PubMed:11112443). Hydrolyzes phosphatidylethanolamine more efficiently than phosphatidylcholine, with only a modest preference for arachidonic acid versus linoelic acid at the sn-2 position. Comparable activity toward 1-palmitoyl-2-oleoyl-phosphatidylserine vesicles to that toward 1-palmitoyl-2-oleoyl-phosphatidylglycerol (By similarity). Hydrolyzes phosphatidylglycerol versus phosphatidylcholine with a 15-fold preference (PubMed:11112443).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes a longer protein (isoform 1), which lacks a signal peptide. With the available conservation data, it is not clear which start codon is most likely used. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220309 | PLA2G2F (Myc-DDK-tagged)-Human phospholipase A2, group IIF (PLA2G2F) |
CNY 2,400.00 |
|
RC220309L3 | Lenti ORF clone of Human phospholipase A2, group IIF (PLA2G2F), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC220309L4 | Lenti ORF clone of Human phospholipase A2, group IIF (PLA2G2F), mGFP tagged |
CNY 5,890.00 |
|
RG220309 | PLA2G2F (tGFP-tagged) - Human phospholipase A2, group IIF (PLA2G2F) |
CNY 4,000.00 |
其它PLA2G2F产品