CCDC25 (NM_018246) Human Untagged Clone
CAT#: SC317313
CCDC25 (untagged)-Human coiled-coil domain containing 25 (CCDC25)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317313 representing NM_018246.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTGTTCTACTTCACCAGCAGCAGCGTTAATTCATCTGCCTACACTATTTACATGGGAAAAGATAAA TATGAAAATGAAGATCTGATCAAGCATGGCTGGCCTGAAGATATCTGGTTTCATGTGGACAAACTCTCT TCGGCTCATGTATACCTTCGATTACATAAGGGAGAGAATATAGAAGACATCCCAAAGGAAGTGCTGATG GACTGTGCCCACCTTGTGAAGGCCAATAGCATTCAAGGCTGCAAGATGAACAACGTTAATGTGGTATAT ACGCCGTGGTCTAACCTGAAGAAAACAGCTGACATGGATGTGGGGCAGATAGGCTTTCACAGGCAGAAG GATGTAAAAATTGTGACAGTGGAGAAGAAAGTAAATGAGATCCTGAACCGATTAGAAAAGACCAAAGTC GAGCGGTTCCCAGACCTAGCAGCAGAGAAAGAATGCAGAGATCGTGAAGAGAGGAATGAGAAAAAAGCC CAAATTCAGGAAATGAAAAAGAGAGAAAAAGAAGAAATGAAGAAGAAGAGGGAAATGGATGAACTTAGG AGCTATTCATCACTAATGAAAGTTGAAAATATGTCTTCAAATCAGGATGGCAATGATTCAGATGAATTC ATGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_018246 |
Insert Size | 627 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_018246.2 |
RefSeq Size | 3653 bp |
RefSeq ORF | 627 bp |
Locus ID | 55246 |
UniProt ID | Q86WR0 |
MW | 24.5 kDa |
Gene Summary | Transmembrane receptor that senses neutrophil extracellular traps (NETs) and triggers the ILK-PARVB pathway to enhance cell motility (PubMed:32528174). NETs are mainly composed of DNA fibers and are released by neutrophils to bind pathogens during inflammation (PubMed:32528174). Formation of NETs is also associated with cancer metastasis, NET-DNA acting as a chemotactic factor to attract cancer cells (PubMed:32528174). Specifically binds NETs on its extracellular region, in particular the 8-OHdG-enriched DNA present in NETs, and recruits ILK, initiating the ILK-PARVB cascade to induce cytoskeleton rearrangement and directional migration of cells (PubMed:32528174). In the context of cancer, promotes cancer metastasis by sensing NETs and promoting migration of tumor cells (PubMed:32528174).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209050 | CCDC25 (Myc-DDK-tagged)-Human coiled-coil domain containing 25 (CCDC25) |
CNY 2,400.00 |
|
RC209050L1 | Lenti ORF clone of Human coiled-coil domain containing 25 (CCDC25), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC209050L2 | Lenti ORF clone of Human coiled-coil domain containing 25 (CCDC25), mGFP tagged |
CNY 5,890.00 |
|
RC209050L3 | Lenti ORF clone of Human coiled-coil domain containing 25 (CCDC25), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC209050L4 | Lenti ORF clone of Human coiled-coil domain containing 25 (CCDC25), mGFP tagged |
CNY 5,890.00 |
|
RG209050 | CCDC25 (tGFP-tagged) - Human coiled-coil domain containing 25 (CCDC25) |
CNY 4,000.00 |
|
SC127751 | CCDC25 (untagged)-Human coiled-coil domain containing 25 (CCDC25) |
CNY 1,200.00 |