TNFSF18 (NM_005092) Human Untagged Clone
CAT#: SC317296
TNFSF18 (untagged)-Human tumor necrosis factor (ligand) superfamily, member 18 (TNFSF18)
CN¥ 3,600.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AITRL; GITRL; hGITRL; TL6; TNLG2A |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_005092 edited
CATGACATTGCATCCTTCACCCATCACTTGTGAATTTTTGTTTTCCACAGCTCTCATTTC TCCAAAAATGTGTTTGAGCCACTTGGAAAATATGCCTTTAAGCCATTCAAGAACTCAAGG AGCTCAGAGATCATCCTGGAAGCTGTGGCTCTTTTGCTCAATAGTTATGTTGCTATTTCT TTGCTCCTTCAGTTGGCTAATCTTTATTTTTCTCCAATTAGAGACTGCTAAGGAGCCCTG TATGGCTAAGTTTGGACCATTACCCTCAAAATGGCAAATGGCATCTTCTGAACCTCCTTG CGTGAATAAGGTGTCTGACTGGAAGCTGGAGATACTTCAGAATGGCTTATATTTAATTTA TGGCCAAGTGGCTCCCAATGCAAACTACAATGATGTAGCTCCTTTTGAGGTGCGGCTGTA TAAAAACAAAGACATGATACAAACTCTAACAAACAAATCTAAAATCCAAAATGTAGGAGG GACTTATGAATTGCATGTTGGGGACACCATAGACTTGATATTCAACTCTGAGCATCAGGT TCTAAAAAATAATACATACTGGGGTATCATTTTACTAGCAAATCCCCAATTCATCTCCTA GAGACTTGATTTGATCTCCTCATTCCCTTCAGCACATGTAGAGGTGCCAGTGGGTGGATT GG |
Restriction Sites | Please inquire |
ACCN | NM_005092 |
Insert Size | 600 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005092.3. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_005092.3, NP_005083.2 |
RefSeq Size | 748 bp |
RefSeq ORF | 600 bp |
Locus ID | 8995 |
UniProt ID | Q9UNG2 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction |
Gene Summary | The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptor TNFRSF18/AITR/GITR. It has been shown to modulate T lymphocyte survival in peripheral tissues. This cytokine is also found to be expressed in endothelial cells, and is thought to be important for interaction between T lymphocytes and endothelial cells. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210901 | TNFSF18 (Myc-DDK-tagged)-Human tumor necrosis factor (ligand) superfamily, member 18 (TNFSF18) |
CN¥ 3,600.00 |
|
RC210901L1 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 18 (TNFSF18), Myc-DDK-tagged |
CN¥ 6,000.00 |
|
RC210901L2 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 18 (TNFSF18), mGFP tagged |
CN¥ 6,000.00 |
|
RC210901L3 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 18 (TNFSF18), Myc-DDK-tagged |
CN¥ 5,890.00 |
|
RC210901L4 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 18 (TNFSF18), mGFP tagged |
CN¥ 6,000.00 |
|
RG210901 | TNFSF18 (tGFP-tagged) - Human tumor necrosis factor (ligand) superfamily, member 18 (TNFSF18) |
CN¥ 5,200.00 |
|
SC303581 | TNFSF18 (untagged)-Human tumor necrosis factor (ligand) superfamily, member 18 (TNFSF18) |
CN¥ 5,130.00 |
其它TNFSF18产品