HEF1 (NEDD9) (NM_182966) Human Untagged Clone

CAT#: SC317272

NEDD9 (untagged)-Human neural precursor cell expressed, developmentally down-regulated 9 (NEDD9), transcript variant 2



  "NM_182966" in other vectors (5)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Mouse monoclonal anti-HEF1 antibody
    • 100 ug

CNY 8,303.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAS-L; CAS2; CASL; CASS2; HEF1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_182966, the custom clone sequence may differ by one or more nucleotides
ATGAAGTATAAGAATCTTATGGCAAGGGCCTTATATGACAATGTCCCAGAGTGTGCCGAG
GAACTGGCCTTTCGCAAGGGAGACATCCTGACCGTCATAGAGCAGAACACAGGGGGACTG
GAAGGATGGTGGCTGTGCTCGTTACACGGTCGGCAAGGCATTGTCCCAGGCAACCGGGTG
AAGCTTCTGATTGGTCCCATGCAGGAGACTGCCTCCAGTCACGAGCAGCCTGCCTCTGGA
CTGATGCAGCAGACCTTTGGCCAACAGAAGCTCTATCAAGTGCCAAACCCACAGGCTGCT
CCCCGAGACACCATCTACCAAGTGCCACCTTCCTACCAAAATCAGGGAATTTACCAAGTC
CCCACTGGCCACGGCACCCAAGAACAAGAGGTATATCAGGTGCCACCATCAGTGCAGAGA
AGCATTGGGGGAACCAGTGGGCCCCACGTGGGTAAAAAGGTGTTCCAGAGAGATGGGCAA
GTGTCCTATTTCTTAGTGAGAGCCTCTAAACAAACCAGCTTG
Restriction Sites Please inquire     
ACCN NM_182966
Insert Size 1329 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_182966.2, NP_892011.2
RefSeq Size 1329 bp
RefSeq ORF 1329 bp
Locus ID 4739
UniProt ID Q14511
Gene Summary The protein encoded by this gene is a member of the CRK-associated substrates family. Members of this family are adhesion docking molecules that mediate protein-protein interactions for signal transduction pathways. This protein is a focal adhesion protein that acts as a scaffold to regulate signaling complexes important in cell attachment, migration and invasion as well as apoptosis and the cell cycle. This protein has also been reported to have a role in cancer metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (2) lacks several exons and includes an alternate 3' terminal exon, compared to variant 1. It encodes isoform 2 which is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...