PIN4 (NM_006223) Human Untagged Clone

CAT#: SC317253

PIN4 (untagged)-Human protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) (PIN4), nuclear gene encoding mitochondrial protein, transcript variant 1



  "NM_006223" in other vectors (7)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
PIN4 mouse monoclonal antibody, clone OTI7H2 (formerly 7H2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EPVH; PAR14; PAR17
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317253 representing NM_006223.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCCATGGCGGGGCTTCTAAAGGGGCTTGTACGGCAACTGGAGCGGTTCAGCGTTCAACAACAAGCT
TCCAAGATGCCGCCCAAAGGAAAAAGTGGTTCTGGAAAAGCGGGGAAAGGGGGAGCAGCCTCTGGGAGT
GACAGTGCTGACAAGAAGGCTCAAGGTCCCAAAGGTGGTGGCAATGCAGTAAAGGTCAGACACATTCTA
TGTGAAAAACATGGCAAAATCATGGAAGCCATGGAAAAGTTAAAGTCTGGGATGAGATTCAATGAAGTG
GCCGCACAGTATAGTGAAGATAAAGCCAGGCAAGGGGGTGACTTGGGTTGGATGACCAGAGGGTCCATG
GTGGGACCATTTCAAGAAGCAGCATTTGCCTTGCCTGTAAGTGGGATGGATAAGCCTGTGTTTACAGAC
CCACCGGTTAAGACAAAATTTGGATATCATATTATTATGGTCGAAGGAAGAAAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_006223
Insert Size 471 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006223.3
RefSeq Size 1331 bp
RefSeq ORF 471 bp
Locus ID 5303
UniProt ID Q9Y237
Domains Rotamase
MW 16.6 kDa
Gene Summary This gene encodes a member of the parvulin subfamily of the peptidyl-prolyl cis/trans isomerase protein family. The encoded protein catalyzes the isomerization of peptidylprolyl bonds, and may play a role in the cell cycle, chromatin remodeling, and/or ribosome biogenesis. The encoded protein may play an additional role in the mitochondria. [provided by RefSeq, Dec 2009]
Transcript Variant: This variant (1) encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to start at a downstream alternate in-frame start codon that is supported by conservation data.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...