ATP6V0E2 (NM_145230) Human Untagged Clone
CAT#: SC317233
ATP6V0E2 (untagged)-Human ATPase, H+ transporting V0 subunit e2 (ATP6V0E2), transcript variant 1
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ATP6V0E2L; C7orf32 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_145230, the custom clone sequence may differ by one or more nucleotides
ATGCGCGTGCGCGGCCCGGCCCGGCTGATCGCTTCGGGTGCTCGACTCCTGTTGCGCATG CTCAGCGCGCTGCCCGGCTGGGGACCCGCGCACCTGCAGCGCCCGCTGCTCGGCCCTGCA TCCTGCCTGGGCATCCTGCGCCCGGCCATGACGGCGCACTCATTCGCCCTCCCGGTCATC ATCTTCACCACGTTCTGGGGCCTCGTCGGCATCGCCGGGCCCTGGTTCGTGCCGAAGGGA CCCAACCGCGGAGTGATCATCACCATGCTGGTCGCCACCGCCGTCTGCTGTTACCTCTTC TGGCTCATCGCCATCCTGGCGCAGCTGAACCCCCTGTTCGGGCCCCAGCTGAAGAATGAG ACCATCTGGTACGTGCGCTTCCTGTGGGAG |
Restriction Sites | Please inquire |
ACCN | NM_145230 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_145230.2, NP_660265.2 |
RefSeq Size | 2727 bp |
RefSeq ORF | 393 bp |
Locus ID | 155066 |
UniProt ID | Q8NHE4 |
Protein Pathways | Epithelial cell signaling in Helicobacter pylori infection, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection |
Gene Summary | Multisubunit vacuolar-type proton pumps, or H(+)-ATPases, acidify various intracellular compartments, such as vacuoles, clathrin-coated and synaptic vesicles, endosomes, lysosomes, and chromaffin granules. H(+)-ATPases are also found in plasma membranes of specialized cells, where they play roles in urinary acidification, bone resorption, and sperm maturation. Multiple subunits form H(+)-ATPases, with proteins of the V1 class hydrolyzing ATP for energy to transport H+, and proteins of the V0 class forming an integral membrane domain through which H+ is transported. ATP6V0E2 encodes an isoform of the H(+)-ATPase V0 e subunit, an essential proton pump component (Blake-Palmer et al., 2007 [PubMed 17350184]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (1) represents the predominantly occurring transcript and it encodes isoform 1. Variants 1 and 6 both encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219960 | ATP6V0E2 (Myc-DDK-tagged)-Human ATPase, H+ transporting V0 subunit e2 (ATP6V0E2), transcript variant 1 |
CNY 3,990.00 |
|
RC219960L3 | Lenti-ORF clone of ATP6V0E2 (Myc-DDK-tagged)-Human ATPase, H+ transporting V0 subunit e2 (ATP6V0E2), transcript variant 1 |
CNY 5,890.00 |
|
RC219960L4 | Lenti-ORF clone of ATP6V0E2 (mGFP-tagged)-Human ATPase, H+ transporting V0 subunit e2 (ATP6V0E2), transcript variant 1 |
CNY 5,890.00 |
|
RG219960 | ATP6V0E2 (tGFP-tagged) - Human ATPase, H+ transporting V0 subunit e2 (ATP6V0E2), transcript variant 1 |
CNY 4,370.00 |
其它ATP6V0E2产品