Tartrate Resistant Acid Phosphatase (ACP5) (NM_001111035) Human Untagged Clone
CAT#: SC317191
ACP5 (untagged)-Human acid phosphatase 5, tartrate resistant (ACP5), transcript variant 1
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HPAP; TRACP5a; TRACP5b; TRAP; TrATPase |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001111035, the custom clone sequence may differ by one or more nucleotides
ATGGACATGTGGACGGCGCTGCTCATCCTGCAAGCCTTGTTGCTACCCTCCCTGGCTGAT GGTGCCACCCCTGCCCTGCGCTTTGTAGCCGTGGGTGACTGGGGAGGGGTCCCCAATGCC CCATTCCACACGGCCCGGGAAATGGCCAATGCCAAGGAGATCGCTCGGACTGTGCAGATC CTGGGTGCAGACTTCATCCTGTCTCTAGGGGACAATTTTTACTTCACTGGTGTGCAAGAC ATCAATGACAAGAGGTTCCAGGAGACCTTTGAGGACGTATTCTCTGACCGCTCCCTTCGC AAAGTGCCCTGGTACGTGCTAGCCGGAAACCATGACCACCTTGGCAATGTCTCTGCCCAG ATTGCATACTCTAAGATCTCCAAGCGCTGGAACTTCCCCAGCCCTTTCTACCGCCTGCAC TTCAAGATCCCACAGACCAATGTGTCTGTGGCCATTTTTATGCTGGACACAGTGACACTA TGTGGCAACTCAGATGACTTCCTCAGCCAGCAGCCTGAGAGGCCCCGAGACGTGAAGCTG GCCCGCACACAGCTGTCCTGGCTCAAGAAACAGCTGGCGGCGGCCAGGGAGGACTACGTG CTGGTGGCTGGCCACTACCCCGTGTGGTCCATAGCCGAGCACGGGCCTACCCACTGCCTG GTCAAGCAGCTACGGCCACTGCTGGCCACATACGGGGTCACTGCCTACCTGTGCGGCCAC GATCACAATCTGCAGTACCTGCAAGATGAGAATGGCGTGGGCTACGTGCTGAGTGGGGCT GGGAATTTCATGGACCCCTCAAAGCGGCACCAGCGCAAGGTCCCCAACGGCTATCTGCGC TTCCACTATGGGACTGAAGACTCACTGGGTGGCTTTGCCTATGTGGAGATCAGCTCCAAA GAGATGACTGTCACTTACATCGAGGCCTCGGGCAAGTCCCTCTTTAAGACCAGGCTGCCG AGGCGAGCCAGGCCC |
Restriction Sites | Please inquire |
ACCN | NM_001111035 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001111035.1, NP_001104505.1 |
RefSeq Size | 1663 bp |
RefSeq ORF | 978 bp |
Locus ID | 54 |
UniProt ID | P13686 |
Protein Families | Druggable Genome |
Protein Pathways | Lysosome, Riboflavin metabolism |
Gene Summary | This gene encodes an iron containing glycoprotein which catalyzes the conversion of orthophosphoric monoester to alcohol and orthophosphate. It is the most basic of the acid phosphatases and is the only form not inhibited by L(+)-tartrate. [provided by RefSeq, Aug 2008] Transcript Variant: This variant (1) represents the longest transcript. Variants 1-5 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225471 | ACP5 (Myc-DDK-tagged)-Human acid phosphatase 5, tartrate resistant (ACP5), transcript variant 1 |
CNY 2,400.00 |
|
RC225471L3 | Lenti-ORF clone of ACP5 (Myc-DDK-tagged)-Human acid phosphatase 5, tartrate resistant (ACP5), transcript variant 1 |
CNY 5,890.00 |
|
RC225471L4 | Lenti-ORF clone of ACP5 (mGFP-tagged)-Human acid phosphatase 5, tartrate resistant (ACP5), transcript variant 1 |
CNY 5,890.00 |
|
RG225471 | ACP5 (tGFP-tagged) - Human acid phosphatase 5, tartrate resistant (ACP5), transcript variant 1 |
CNY 4,000.00 |
其它Tartrate Resistant Acid Phosphatase产品