RNASE9 (NM_001110359) Human Untagged Clone

CAT#: SC317187

RNASE9 (untagged)-Human ribonuclease, RNase A family, 9 (non-active) (RNASE9), transcript variant 1



  "NM_001110359" in other vectors (4)

CN¥ 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
RNASE9 mouse monoclonal antibody,clone OTI4F12
    • 100 ul

CN¥ 1,999.00
CN¥ 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms h461; HEL128; RAK1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001110359, the custom clone sequence may differ by one or more nucleotides
ATGTCTGCAGGAAAAATGATGAGAACTCTCATCACCACACACCCACTGCCCCTGCTTCTA
TTGCCGCAGCAGCTGCTGCAGCTGGTGCAGTTTCAAGAGGTGGATACAGATTTTGATTTC
CCAGAAGAAGATAAAAAAGAAGAATTTGAAGAGTGTTTGGAAAAATTTTTTAGTACAGGG
CCCGCCAGACCACCTACCAAAGAAAAAGTCAAAAGACGTGTCCTTATTGAACCTGGAATG
CCACTAAATCATATAGAGTACTGTAACCATGAAATCATGGGAAAAAATGTTTACTACAAA
CACCGTTGGGTGGCAGAACATTACTTCCTTCTTATGCAATATGACGAGCTCCAAAAAATC
TGTTACAACAGATTTGTGCCATGTAAGAATGGAATTAGGAAATGTAACAGGAGCAAAGGT
CTTGTAGAAGGAGTGTATTGTAATTTAACAGAAGCATTTGAAATACCAGCGTGTAAATAC
GAATCACTTTATAGGAAGGGCTACGTCCTTATCACTTGTTCATGGCAAAATGAAATGCAA
AAACGTATTCCTCATACTATAAATGATCTCGTGGAGCCACCTGAACACAGAAGTTTCCTC
AGTGAGGATGGTGTCTTTGTCATATCGCCC
Restriction Sites Please inquire     
ACCN NM_001110359
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001110359.1, NP_001103829.1
RefSeq Size 1266 bp
RefSeq ORF 633 bp
Locus ID 390443
UniProt ID P60153
Protein Families Secreted Protein
Gene Summary Does not exhibit any ribonuclease activity.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1, also known as alpha123') represents the longest transcript and encodes the longer isoform (1). Variants 1, 2, 3, and 4 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...