ATP6V0E2 (NM_001100592) Human Untagged Clone

CAT#: SC316681

ATP6V0E2 (untagged)-Human ATPase, H+ transporting V0 subunit e2 (ATP6V0E2), transcript variant 2



  "NM_001100592" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ATP6V0E2 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ATP6V0E2L; C7orf32
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316681 representing NM_001100592.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGCGTGCGCGGCCCGGCCCGGCTGATCGCTTCGGGTGCTCGACTCCTGTTGCGCATGCTCAGCGCG
CTGCCCGGCTGGGGACCCGCGCACCTGCAGCGCCCGCTGCTCGGCCCTGCATCCTGCCTGGGCATCCTG
CGCCCGGCCATGACGGCGCACTCATTCGCCCTCCCGGTCATCATCTTCACCACGTTCTGGGGCCTCGTC
GGCATCGCCGGGCCCTGGTTCGTGCCGAAGGGACCCAACCGCGGAGTGATCATCACCATGCTGGTCGCC
ACCGCCGTCTGCTGTTACCTCTTGTGCCCAGCTCTCGGAATGACTGTGGCTCCACTGTCCCTGACAACC
CCTTCGTCCGGACCCTCCCCCACACAACTATGTCTGGTCACCAGCTCCCTCCTGCTGGCACCCAGAGAC
CCGGACCCGCAGGGCCTGCCTGGTTCCTGGAAGTCTTCCCAGTCTTCCCAGCCAGCCCGGGCCCTGGGG
AGCCCTGGGCACAGCAGCGGCCGAGGGGATGTCCTGCTCCAATACCCGCACTGCTCTGGAGTTTGCCCT
CTTTCCCAAGGAGATGCTGCTGGGGAGCTGGTATGGGTGGGGTCTTTCCCTTTACAGACGGGGCAGATG
CCAGGACTCAGCCCATCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001100592
Insert Size 642 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001100592.2
RefSeq Size 2635 bp
RefSeq ORF 642 bp
Locus ID 155066
UniProt ID Q8NHE4
Protein Pathways Epithelial cell signaling in Helicobacter pylori infection, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection
MW 22 kDa
Gene Summary Multisubunit vacuolar-type proton pumps, or H(+)-ATPases, acidify various intracellular compartments, such as vacuoles, clathrin-coated and synaptic vesicles, endosomes, lysosomes, and chromaffin granules. H(+)-ATPases are also found in plasma membranes of specialized cells, where they play roles in urinary acidification, bone resorption, and sperm maturation. Multiple subunits form H(+)-ATPases, with proteins of the V1 class hydrolyzing ATP for energy to transport H+, and proteins of the V0 class forming an integral membrane domain through which H+ is transported. ATP6V0E2 encodes an isoform of the H(+)-ATPase V0 e subunit, an essential proton pump component (Blake-Palmer et al., 2007 [PubMed 17350184]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) lacks an alternate segment in the 3' coding region, compared to variant 1, that causes a frameshift. The resulting protein (isoform 2) has a longer and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...