United States
Germany
Japan
United Kingdom
China
TGF alpha (TGFA) (NM_001099691) Human Untagged Clone
CAT＃: SC316662
TGFA (untagged)-Human transforming growth factor, alpha (TGFA), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | TFGA |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC316662 representing NM_001099691.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTCCCCTCGGCTGGACAGCTCGCCCTGTTCGCTCTGGGTATTGTGTTGGCTGCGTGCCAGGCCTTG GAGAACAGCACGTCCCCGCTGAGTGACCCGCCCGTGGCTGCAGCAGTGGTGTCCCATTTTAATGACTGC CCAGATTCCCACACTCAGTTCTGCTTCCATGGAACCTGCAGGTTTTTGGTGCAGGAGGACAAGCCAGCA TGTGTCTGCCATTCTGGGTACGTTGGTGCACGCTGTGAGCATGCGGACCTCCTGGCCGTGGTGGCTGCC AGCCAGAAGAAGCAGGCCATCACCGCCTTGGTGGTGGTCTCCATCGTGGCCCTGGCTGTCCTTATCATC ACATGTGTGCTGATACACTGCTGCCAGGTCCGAAAACACTGTGAGTGGTGCCGGGCCCTCATCTGCCGG CACGAGAAGCCCAGCGCCCTCCTGAAGGGAAGAACCGCTTGCTGCCACTCAGAAACAGTGGTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001099691 |
| Insert Size | 480 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001099691.2 |
| RefSeq Size | 4323 bp |
| RefSeq ORF | 480 bp |
| Locus ID | 7039 |
| UniProt ID | P01135 |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| Protein Pathways | ErbB signaling pathway, Glioma, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Prostate cancer, Renal cell carcinoma |
| MW | 16.9 kDa |
| Gene Summary | This gene encodes a growth factor that is a ligand for the epidermal growth factor receptor, which activates a signaling pathway for cell proliferation, differentiation and development. This protein may act as either a transmembrane-bound ligand or a soluble ligand. This gene has been associated with many types of cancers, and it may also be involved in some cases of cleft lip/palate. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The encoded isoform (2) is one amino acid shorter than isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218141 | TGFA (Myc-DDK-tagged)-Human transforming growth factor, alpha (TGFA), transcript variant 2 |
CNY 1,800.00 |
|
| RC218141L3 | Lenti ORF clone of Human transforming growth factor, alpha (TGFA), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC218141L4 | Lenti ORF clone of Human transforming growth factor, alpha (TGFA), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG218141 | TGFA (tGFP-tagged) - Human transforming growth factor, alpha (TGFA), transcript variant 2 |
CNY 3,400.00 |
其它TGF alpha产品
