CDK10 (NM_001098533) Human Untagged Clone

CAT#: SC316362

CDK10 (untagged)-Human cyclin-dependent kinase 10 (CDK10), transcript variant c



  "NM_001098533" in other vectors (4)

CN¥ 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-CDK10 Rabbit Polyclonal Antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALSAS; PISSLRE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316362 representing NM_001098533.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACAAGGAGAAGGATGGCATCCCCATCAGCAGCTTGCGGGAGATCACGCTGCTGCTCCGCCTGCGT
CATCCGAACATCGTGGAGCTGAAGGAGGTGGTTGTGGGGAACCACCTGGAGAGCATCTTCCTGGTGATG
GGTTACTGTGAGCAGGACCTGGCCAGCCTCCTGGAGAATATGCCAACACCCTTCTCGGAGGCTCAGGTC
AAGTGCATCGTGCTGCAGGTGCTCCGGGGCCTCCAGTATCTGCACAGGAACTTCATTATCCACAGGGAC
CTGAAGGTTTCCAACTTGCTCATGACCGACAAGGGTTGTGTGAAGACAGCGGATTTCGGCCTGGCCCGG
GCCTATGGTGTCCCAGTAAAGCCAATGACCCCCAAGGTGGTCACTCTCTGGTACCGAGCCCCTGAACTG
CTGTTGGGAACCACCACGCAGACCACCAGCATCGACATGTGGGCTGTGGGCTGCATACTGGCCGAGCTG
CTGGCGCACAGGCCTCTTCTCCCCGGCACTTCCGAGATCCACCAGATCGACTTGATCGTGCAGCTGCTG
GGCACGCCCAGTGAGAACATCTGGCCGGGCTTTTCCAAGCTGCCACTGGTCGGCCAGTACAGCCTCCGG
AAGCAGCCCTACAACAACCTGAAGCACAAGTTCCCATGGCTGTCGGAGGCCGGGCTGCGCCTGCTGCAC
TTCCTGTTCATGGCGACGGCCGGGGACTGCCTGGAGAGCTCCTATTTCAAGGAGAAGCCCCTACCCTGT
GAGCCGGAGCTCATGCCGACCTTTCCCCACCACCGCAACAAGCGGGCCGCCCCAGCCACCTCCGAGGGC
CAGAGCAAGCGCTGTAAACCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001098533
Insert Size 852 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001098533.2
RefSeq Size 1759 bp
RefSeq ORF 852 bp
Locus ID 8558
UniProt ID Q15131
Protein Families Druggable Genome, Protein Kinase
MW 31.9 kDa
Gene Summary The protein encoded by this gene belongs to the CDK subfamily of the Ser/Thr protein kinase family. The CDK subfamily members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and are known to be essential for cell cycle progression. This kinase has been shown to play a role in cellular proliferation and its function is limited to cell cycle G2-M phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Transcript Variant: This variant (c) uses an alternate donor splice site at the first exon resulting in translation from a downstream start codon, and uses an alternate donor splice site in the 3' coding region, compared to variant a. The resulting isoform (c) has a shorter N-terminus and lacks a 6-aa segment near the C-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...