FAM89B (NM_001098785) Human Untagged Clone

CAT#: SC316341

FAM89B (untagged)-Human family with sequence similarity 89, member B (FAM89B), transcript variant 1



  "NM_001098785" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-FAM89B Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LRAP25; MTVR; MTVR1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316341 representing NM_001098785.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACGGGCTGCCCTCGGCAGAGGCGCCGGGCGGGGCGGGCTGCGCTTTGGCCGGGCTCCCACCGCTG
CCGCGCGGCCTCAGCGGCCTCCTTAATGCGAGCGGGGGCTCGTGGCGGGAGCTGGAGCGCGTCTACAGC
CAGCGCAGCCGCATCCACGACGAGCTGAGCCGCGCCGCCCGCGCCCCGGACGGGCCCCGCCACGCCGCC
GGCGCCGCCAACGCGGGACCCGCAGCCGGCCCGCGTCGTCCTGTCAACCTCGACTCAGCGCTGGCCGCG
CTGCGCAAGGAGATGGTGGGGCTGCGGCAGTTGGACATGTCCTTGTTGTGCCAGCTGTGGGGCCTGTAC
GAGTCAATCCAGGACTACAAACACCTGTGCCAAGACCTGAGCTTCTGCCAGGACCTGTCATCCTCCCTC
CATTCGGACAGCTCCTACCCACCGGATGCGGGCCTGTCTGACGACGAGGAGCCTCCCGATGCCAGCCTG
CCTCCTGACCCGCCACCCCTTACTGTGCCCCAGACGCACAATGCCCGTGACCAGTGGCTGCAGGATGCC
TTCCACATCAGCCTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001098785
Insert Size 570 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001098785.1
RefSeq Size 1467 bp
RefSeq ORF 570 bp
Locus ID 23625
UniProt ID Q8N5H3
Protein Families Druggable Genome
MW 20.1 kDa
Gene Summary Negatively regulates TGF-beta-induced signaling; in cooperation with SKI prevents the translocation of SMAD2 from the nucleus to the cytoplasm in response to TGF-beta. Acts as an adapter that mediates the specific recognition of LIMK1 by CDC42BPA and CDC42BPB in the lamellipodia. LRAP25-mediated CDC42BPA/CDC42BPB targeting to LIMK1 and the lamellipodium results in LIMK1 activation and the subsequent phosphorylation of CFL1 which is important for lamellipodial F-actin regulation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...