FAM89B (NM_001098785) Human Untagged Clone
CAT#: SC316341
FAM89B (untagged)-Human family with sequence similarity 89, member B (FAM89B), transcript variant 1
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LRAP25; MTVR; MTVR1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC316341 representing NM_001098785.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAACGGGCTGCCCTCGGCAGAGGCGCCGGGCGGGGCGGGCTGCGCTTTGGCCGGGCTCCCACCGCTG CCGCGCGGCCTCAGCGGCCTCCTTAATGCGAGCGGGGGCTCGTGGCGGGAGCTGGAGCGCGTCTACAGC CAGCGCAGCCGCATCCACGACGAGCTGAGCCGCGCCGCCCGCGCCCCGGACGGGCCCCGCCACGCCGCC GGCGCCGCCAACGCGGGACCCGCAGCCGGCCCGCGTCGTCCTGTCAACCTCGACTCAGCGCTGGCCGCG CTGCGCAAGGAGATGGTGGGGCTGCGGCAGTTGGACATGTCCTTGTTGTGCCAGCTGTGGGGCCTGTAC GAGTCAATCCAGGACTACAAACACCTGTGCCAAGACCTGAGCTTCTGCCAGGACCTGTCATCCTCCCTC CATTCGGACAGCTCCTACCCACCGGATGCGGGCCTGTCTGACGACGAGGAGCCTCCCGATGCCAGCCTG CCTCCTGACCCGCCACCCCTTACTGTGCCCCAGACGCACAATGCCCGTGACCAGTGGCTGCAGGATGCC TTCCACATCAGCCTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001098785 |
Insert Size | 570 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001098785.1 |
RefSeq Size | 1467 bp |
RefSeq ORF | 570 bp |
Locus ID | 23625 |
UniProt ID | Q8N5H3 |
Protein Families | Druggable Genome |
MW | 20.1 kDa |
Gene Summary | Negatively regulates TGF-beta-induced signaling; in cooperation with SKI prevents the translocation of SMAD2 from the nucleus to the cytoplasm in response to TGF-beta. Acts as an adapter that mediates the specific recognition of LIMK1 by CDC42BPA and CDC42BPB in the lamellipodia. LRAP25-mediated CDC42BPA/CDC42BPB targeting to LIMK1 and the lamellipodium results in LIMK1 activation and the subsequent phosphorylation of CFL1 which is important for lamellipodial F-actin regulation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218225 | FAM89B (Myc-DDK-tagged)-Human family with sequence similarity 89, member B (FAM89B), transcript variant 1 |
CNY 2,400.00 |
|
RC218225L3 | Lenti ORF clone of Human family with sequence similarity 89, member B (FAM89B), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC218225L4 | Lenti ORF clone of Human family with sequence similarity 89, member B (FAM89B), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG218225 | FAM89B (tGFP-tagged) - Human family with sequence similarity 89, member B (FAM89B), transcript variant 1 |
CNY 4,370.00 |