GJB1 (NM_001097642) Human Untagged Clone

CAT#: SC316177

GJB1 (untagged)-Human gap junction protein, beta 1, 32kDa (GJB1), transcript variant 1



  "NM_001097642" in other vectors (4)

CN¥ 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00


Rabbit Polyclonal Anti-GJB1 Antibody
    • 50 ug

CN¥ 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CMTX; CMTX1; CX32
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316177 representing NM_001097642.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACTGGACAGGTTTGTACACCTTGCTCAGTGGCGTGAACCGGCATTCTACTGCCATTGGCCGAGTA
TGGCTCTCGGTCATCTTCATCTTCAGAATCATGGTGCTGGTGGTGGCTGCAGAGAGTGTGTGGGGTGAT
GAGAAATCTTCCTTCATCTGCAACACACTCCAGCCTGGCTGCAACAGCGTTTGCTATGACCAATTCTTC
CCCATCTCCCATGTGCGGCTGTGGTCCCTGCAGCTCATCCTAGTTTCCACCCCAGCTCTCCTCGTGGCC
ATGCACGTGGCTCACCAGCAACACATAGAGAAGAAAATGCTACGGCTTGAGGGCCATGGGGACCCCCTA
CACCTGGAGGAGGTGAAGAGGCACAAGGTCCACATCTCAGGGACACTGTGGTGGACCTATGTCATCAGC
GTGGTGTTCCGGCTGTTGTTTGAGGCCGTCTTCATGTATGTCTTTTATCTGCTCTACCCTGGCTATGCC
ATGGTGCGGCTGGTCAAGTGCGACGTCTACCCCTGCCCCAACACAGTGGACTGCTTCGTGTCCCGCCCC
ACCGAGAAAACCGTCTTCACCGTCTTCATGCTAGCTGCCTCTGGCATCTGCATCATCCTCAATGTGGCC
GAGGTGGTGTACCTCATCATCCGGGCCTGTGCCCGCCGAGCCCAGCGCCGCTCCAATCCACCTTCCCGC
AAGGGCTCGGGCTTCGGCCACCGCCTCTCACCTGAATACAAGCAGAATGAGATCAACAAGCTGCTGAGT
GAGCAGGATGGCTCCCTGAAAGACATACTGCGCCGCAGCCCTGGCACCGGGGCTGGGCTGGCTGAAAAG
AGCGACCGCTGCTCGGCCTGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001097642
Insert Size 852 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001097642.2
RefSeq Size 1623 bp
RefSeq ORF 852 bp
Locus ID 2705
UniProt ID P08034
Protein Families Druggable Genome, Ion Channels: Other, Transmembrane
MW 32 kDa
Gene Summary This gene encodes a member of the gap junction protein family. The gap junction proteins are membrane-spanning proteins that assemble to form gap junction channels that facilitate the transfer of ions and small molecules between cells. According to sequence similarities at the nucleotide and amino acid levels, the gap junction proteins are divided into two categories, alpha and beta. Mutations in this gene cause X-linked Charcot-Marie-Tooth disease, an inherited peripheral neuropathy. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (1) represents the shorter transcript, and is transcribed from promoter P1. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...