United States
Germany
Japan
United Kingdom
China
SFTPA1 (NM_001093770) Human Untagged Clone
CAT＃: SC316168
SFTPA1 (untagged)-Human surfactant protein A1 (SFTPA1), transcript variant 2
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | COLEC4; PSAP; PSP-A; PSPA; SFTP1; SFTPA1B; SP-A; SP-A1; SP-A1 beta; SP-A1 delta; SP-A1 epsilon; SP-A1 gamma; SPA; SPA1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001093770 edited
ATGAGGCCATGCCAGGTGCCAGGAGCAGCGACTGGACCCAGAGCCATGTGGCTGTGCCCT CTGGCCCTCAACCTCATCTTGATGGCAGCCTCTGGTGCTGTGTGCGAAGTGAAGGACGTT TGTGTTGGAAGCCCTGGTATCCCCGGCACTCCTGGATCCCACGGCCTGCCAGGCAGGGAC GGGAGAGATGGTCTCAAAGGAGACCCTGGCCCTCCAGGCCCCATGGGTCCACCTGGAGAA ATGCCATGTCCTCCTGGAAATGATGGGCTGCCTGGAGCCCCTGGTATCCCTGGAGAGTGT GGAGAGAAGGGGGAGCCTGGCGAGAGGGGCCCTCCAGGGCTTCCAGCTCATCTAGATGAG GAGCTCCAAGCCACACTCCACGACTTTAGACATCAAATCCTGCAGACAAGGGGAGCCCTC AGTCTGCAGGGCTCCATAATGACAGTAGGAGAGAAGGTCTTCTCCAGCAATGGGCAGTCC ATCACTTTTGATGCCATTCAGGAGGCATGTGCCAGAGCAGGCGGCCGCATTGCTGTCCCA AGGAATCCAGAGGAAAATGAGGCCATTGCAAGCTTCGTGAAGAAGTACAACACATATGCC TATGTAGGCCTGACTGAGGGTCCCAGCCCTGGAGACTTCCGCTACTCAGACGGGACCCCT GTAAACTACACCAACTGGTACCGAGGGGAGCCCGCAGGTCGGGGAAAAGAGCAGTGTGTG GAGATGTACACAGATGGGCAGTGGAATGACAGGAACTGCCTGTACTCCCGACTGACCATC TGTGAGTTCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001093770 |
| Insert Size | 800 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001093770.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001093770.1, NP_001087239.1 |
| RefSeq Size | 1311 bp |
| RefSeq ORF | 738 bp |
| Locus ID | 653509 |
| UniProt ID | Q8IWL2 |
| Gene Summary | This gene encodes a lung surfactant protein that is a member of a subfamily of C-type lectins called collectins. The encoded protein binds specific carbohydrate moieties found on lipids and on the surface of microorganisms. This protein plays an essential role in surfactant homeostasis and in the defense against respiratory pathogens. Mutations in this gene are associated with idiopathic pulmonary fibrosis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010] Transcript Variant: This variant (2) differs in the 5' UTR and includes an additional segment in the 5' coding region, compared to variant 1. The encoded isoform (2) has a longer and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215681 | SFTPA1 (Myc-DDK-tagged)-Human surfactant protein A1 (SFTPA1), transcript variant 2 |
CNY 3,990.00 |
|
| RC215681L3 | Lenti-ORF clone of SFTPA1 (Myc-DDK-tagged)-Human surfactant protein A1 (SFTPA1), transcript variant 2 |
CNY 5,890.00 |
|
| RC215681L4 | Lenti-ORF clone of SFTPA1 (mGFP-tagged)-Human surfactant protein A1 (SFTPA1), transcript variant 2 |
CNY 5,890.00 |
|
| RG215681 | SFTPA1 (tGFP-tagged) - Human surfactant protein A1 (SFTPA1), transcript variant 2 |
CNY 4,370.00 |
|
| SC327769 | SFTPA1 (untagged)-Human surfactant protein A1 (SFTPA1) transcript variant 2 |
CNY 5,130.00 |
