United States
Germany
Japan
United Kingdom
China
NFE4 (NM_001085386) Human Untagged Clone
CAT＃: SC316149
NFE4 (untagged)-Human transcription factor NF-E4 (NFE4)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | NF-E4 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001085386, the custom clone sequence may differ by one or more nucleotides
CTGCCTCGTGTTGTCTGTTGGCACACTCTCAAGAGTTTGAACGGATACAAGAATCTTTCATCTGGTGCCG AAACCCGGGAGGGGCTCCGGTCTTCGTCCCCCGTGGACCTACCCCTCCGCCCCAGAAAGCAGGCCACAGC AGCCGGACAAAGGAAGCTCCTCAGCCTCCAGTTGCTTCTCTGTGCATGCACATCAGTCACTGATCTCACC TACTGGGGCCCTGCAGGCCATGGGGCCACAGCTCCACACAGAAGCCTCCTAGCAATCCACCTCCACCTGG TGCCTGCTTCAAGTGCGGCAATGAAGGCCACTGGCCCACACAATGCCCAAACCCAGGTAAACCCACGAGG CCATGCCCCCTCTGCGGAGGACCCCACTGGAAGTTGGACTGTGAGCGGCCCCTGCAAGGACCACCCCCAT CCCTTCCTGAGCCAATCAAACCCTCCTACTCGGATCTCGTCAGCCTTGCCGCTGAAGACTGATAGTGCCT TGGAACAGACACCCCAGCAACTACCATCGCTTCATCTGAGCCAAGGGTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001085386 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001085386.1, NP_001078855.1 |
| RefSeq Size | 967 bp |
| RefSeq ORF | 540 bp |
| Locus ID | 58160 |
| Gene Summary | The erythroid-specific protein encoded by this gene, and the ubiquitous transcription factor CP2, form the stage selector protein (SSP) complex, which is involved in preferential expression of the gamma-globin genes in fetal erythroid cells. Alternate use of an in-frame upstream non-AUG (CUG) translation initiation codon, and a downstream AUG codon, results in two isoforms. While the long isoform (22 kDa) acts as an activator, the short isoform (14 kDa) has been shown to repress gamma-globin gene expression. This gene is located in an intron of the FBXL13 gene on the opposite strand. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220641 | NFE4 (Myc-DDK-tagged)-Human transcription factor NF-E4 (NFE4) |
CNY 2,400.00 |
|
| RC220641L3 | Lenti ORF clone of Human transcription factor NF-E4 (NFE4), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC220641L4 | Lenti ORF clone of Human transcription factor NF-E4 (NFE4), mGFP tagged |
CNY 5,890.00 |
|
| RG220641 | NFE4 (tGFP-tagged) - Human transcription factor NF-E4 (NFE4) |
CNY 4,370.00 |
