Adenosine A3 Receptor (ADORA3) (NM_001081976) Human Untagged Clone
CAT#: SC315984
ADORA3 (untagged)-Human adenosine A3 receptor (ADORA3), transcript variant 3
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AD026 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC315984 representing NM_001081976.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAAGGGTCTCCAGCAGGACCCATTGAGCAGAAGGAGGCCAGGTGGGAAAGCTCCTGGGAAGAGCAG CCAGACTGGACACTGGGCTGCTTGAGTCCTGAGTCACAATTCAGAATTCCTGGGCTCCCTGGGTGCATT CTATCATTCCAGTTGAAAGTTTGCTTCCTTCCAGTCATGTGGCTCTTCATTCTACTCTCCTTGGCTCTC ATTTCAGATGCCATGGTCATGGATGAAAAGGTCAAGAGAAGCTTTGTGCTGGACACGGCTTCTGCCATC TGCAACTACAATGCCCACTACAAGAATCACCCCAAATACTGGTGCCGAGGCTATTTCCGTGACTACTGC AACATCATCGCCTTCTCCCCTAACAGCACCAATCATGTGGCCCTGAGGGACACAGGGAACCAGCTCATT GTCACTATGTCCTGCCTGACCAAAGAGGACACGGGCTGGTACTGGTGTGGCATCCAGCGGGACTTTGCC AGGGATGACATGGATTTTACAGAGCTGATTGTAACTGACGACAAAGGAACCCTGGCCAATGACTTTTGG TCTGGGAAAGACCTATCAGGCAACAAAACCAGAAGCTGCAAGGCTCCCAAAGTTGTCCGCAAGGCTGAC CGCTCCAGGACGTCCATTCTCATCATTTGCATACTGATCACGGGTTTGGGAATCATCTCTGTAATCAGT CATTTGACCAAAAGGAGGAGAAGTCAAAGGAATAGAAGGGTAGGCAACACTTTGAAGCCCTTCTCGCGT GTCCTGACTCCAAAGGAAATGGCTCCTACTGAACAGATGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001081976 |
Insert Size | 801 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001081976.2 |
RefSeq Size | 1213 bp |
RefSeq ORF | 801 bp |
Locus ID | 57413 |
UniProt ID | P33765 |
MW | 30.3 kDa |
Gene Summary | This gene encodes a transmembrane and immunoglobulin domain-containing protein. Alternative splicing results in multiple transcript variants, one of which shares its 5' terminal exon with that of the overlapping adenosine A3 receptor gene (GeneID:140), thus resulting in a fusion product. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (3) contains an alternate 5' terminal exon, resulting in an alternate 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1, and it does not share any similarity with the adenosine A3 receptor. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214903 | ADORA3 (Myc-DDK-tagged)-Human adenosine A3 receptor (ADORA3), transcript variant 3 |
CNY 3,600.00 |
|
RC214903L3 | Lenti ORF clone of Human adenosine A3 receptor (ADORA3), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214903L4 | Lenti ORF clone of Human adenosine A3 receptor (ADORA3), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG214903 | ADORA3 (tGFP-tagged) - Human adenosine A3 receptor (ADORA3), transcript variant 3 |
CNY 5,200.00 |
其它Adenosine A3 Receptor产品