LILRB2 (NM_001080978) Human Untagged Clone
CAT#: SC315962
LILRB2 (untagged)-Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), transcript variant 2
CNY 6,680.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD85D; ILT-4; ILT4; LIR-2; LIR2; MIR-10; MIR10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001080978 edited
ATGACCCCCATCGTCACAGTCCTGATCTGTCTCGGGCTGAGTCTGGGCCCCAGGACCCAC GTGCAGACAGGGACCATCCCCAAGCCCACCCTGTGGGCTGAGCCAGACTCTGTGATCACC CAGGGGAGTCCCGTCACCCTCAGTTGTCAGGGGAGCCTTGAAGCCCAGGAGTACCGTCTA TATAGGGAGAAAAAATCAGCATCTTGGATTACACGGATACGACCAGAGCTTGTGAAGAAC GGCCAGTTCCACATCCCATCCATCACCTGGGAACACACAGGGCGATATGGCTGTCAGTAT TACAGCCGCGCTCGGTGGTCTGAGCTCAGTGACCCCCTGGTGCTGGTGATGACAGGAGCC TACCCAAAACCCACCCTCTCAGCCCAGCCCAGCCCTGTGGTGACCTCAGGAGGAAGGGTG ACCCTCCAGTGTGAGTCACAGGTGGCATTTGGCGGCTTCATTCTGTGTAAGGAAGGAGAA GATGAACACCCACAATGCCTGAACTCCCAGCCCCATGCCCGTGGGTCGTCCCGCGCCATC TTCTCCGTGGGCCCCGTGAGCCCGAATCGCAGGTGGTCGCACAGGTGCTATGGTTATGAC TTGAACTCTCCCTATGTGTGGTCTTCACCCAGTGATCTCCTGGAGCTCCTGGTCCCAGGT GTTTCTAAGAAGCCATCACTCTCAGTGCAGCCGGGTCCTGTCGTGGCCCCTGGGGAAAGC CTGACCCTCCAGTGTGTCTCTGATGTCGGCTATGACAGATTTGTTCTGTACAAGGAGGGG GAACGTGACCTTCGCCAGCTCCCTGGCCGGCAGCCCCAGGCTGGGCTCTCCCAGGCCAAC TTCACCCTGGGCCCTGTGAGCCGCTCCTACGGGGGCCAGTACAGATGCTACGGTGCATAC AACCTCTCCTCCGAGTGGTCGGCCCCCAGCGACCCCCTGGACATCCTGATCACAGGACAG ATCCATGGCACACCCTTCATCTCAGTGCAGCCAGGCCCCACAGTGGCCTCAGGAGAGAAC GTGACCCTGCTGTGTCAGTCATGGCGGCAGTTCCACACTTTCCTTCTGACCAAGGCGGGA GCAGCTGATGCCCCACTCCGTCTAAGATCAATACACGAATATCCTAAGTACCAGGCTGAA TTCCCCATGAGTCCTGTGACCTCAGCCCACGCGGGGACCTACAGGTGCTACGGCTCACTC AACTCCGACCCCTACCTGCTGTCTCACCCCAGTGAGCCCCTGGAGCTCGTGGTCTCAGGA CCCTCCATGGGTTCCAGCCCCCCACCCACCGGTCCCATCTCCACACCTGCAGGCCCTGAG GACCAGCCCCTCACCCCCACTGGGTCGGATCCCCAAAGTGGTCTGGGAAGGCACCTGGGG GTTGTGATCGGCATCTTGGTGGCCGTCGTCCTACTGCTCCTCCTCCTCCTCCTCCTCTTC CTCATCCTCCGACATCGACGTCAGGGCAAACACTGGACATCAACCCAGAGAAAGGCTGAT TTCCAACATCCTGCAGGGGCTGTGGGGCCAGAGCCCACAGACAGAGGCCTGCAGTGGAGG TCCAGCCCAGCTGCCGACGCCCAGGAAGAAAACCTCTATGCTGCCGTGAAGGACACACAG CCTGAAGATGGGGTGGAGATGGACACTCGGGCTGCTGCATCTGAAGCCCCCCAGGATGTG ACCTACGCCCAGCTGCACAGCTTGACCCTCAGACGGAAGGCAACTGAGCCTCCTCCATCC CAGGAAGGGGAACCTCCAGCTGAGCCCAGCATCTACGCCACCCTGGCCATCCACTAG |
Restriction Sites | Please inquire |
ACCN | NM_001080978 |
Insert Size | 1800 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001080978.1, NP_001074447.1 |
RefSeq Size | 2910 bp |
RefSeq ORF | 1794 bp |
Locus ID | 10288 |
Protein Families | Transmembrane |
Gene Summary | This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1. Both variants 2 and 3 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217935 | LILRB2 (Myc-DDK-tagged)-Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), transcript variant 2 |
CNY 6,680.00 |
|
RC217935L1 | Lenti ORF clone of Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), transcript variant 2, Myc-DDK-tagged |
CNY 9,080.00 |
|
RC217935L2 | Lenti ORF clone of Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), transcript variant 2, mGFP tagged |
CNY 9,080.00 |
|
RC217935L3 | Lenti ORF clone of Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), transcript variant 2, Myc-DDK-tagged |
CNY 9,080.00 |
|
RC217935L4 | Lenti ORF clone of Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), transcript variant 2, mGFP tagged |
CNY 6,460.00 |
|
RG217935 | LILRB2 (tGFP-tagged) - Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), transcript variant 2 |
CNY 8,280.00 |