United States
Germany
Japan
United Kingdom
China
NXF1 (NM_001081491) Human Untagged Clone
CAT＃: SC315942
NXF1 (untagged)-Human nuclear RNA export factor 1 (NXF1), transcript variant 2
CNY 3,656.00
CNY 5,800.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MEX67; TAP |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001081491 edited
ATGGCGGACGAGGGGAAGTCGTACAGCGAACACGATGATGAACGCGTTAATTTCCCTCAA AGAAAGAAGAAAGGCCGGGGTCCCTTCCGGTGGAAATATGGTGAAGGAAACCGTAGGTCT GGAAGAGGCGGTTCTGGTATTCGGTCTTCCCGCCTTGAGGAAGATGATGGAGATGTGGCA ATGAGTGATGCCCAGGATGGTCCCCGAGTACGATACAACCCCTATACCACCCGACCTAAC CGTCGGGGTGATACTTGGCATGATCGAGATCGCATTCATGTTACTGTGCGGAGAGACAGA GCTCCTCCAGAGAGAGGAGGGGCTGGCACCAGCCAGGATGGGACCTCAAAGAACTGGTTC AAGATTACAATTCCTTATGGCAGAAAGTATGACAAGGCATGGCTCCTGAGCATGATTCAG AGCAAGTGCAGTGTGCCCTTCACCCCTATTGAGTTTCACTATGAGAATACACGGGCCCAG TTCTTCGTTGAAGACGCCAGTACTGCCTCTGCATTGAAGGCTGTCAACTATAAGATTTTG GATCGGGAGAACCGAAGGATATCTATCATCATCAACTCTTCTGCTCCACCCCACACTATA CTGAATGAACTGAAGCCAGAACAAGTAGAACAGCTAAAGCTGATCATGAGCAAACGATAC GATGGCTCCCAACAAGCCCTTGACCTCAAAGGCCTCCGTTCAGACCCAGATTTGGTGGCC CAGAACATTGACGTTGTCCTGAATCGCAGAAGCTGTATGGCAGCTACCCTGAGGATCATT GAAGAGAACATCCCTGAGCTATTGTCCTTGAACTTGAGCAACAACAGGCTGTACAGGCTG GATGACATGTCTAGCATTGTTCAGAAGGCACCCAACCTGAAGATCCTAAACCTTTCTGGA AATGAATTGAAGTCTGAGCGGGAATTGGACAAGATAAAGGGGCTGAAGCTAGAAGAGCTC TGGCTCGATGGAAACTCCCTGTGTGACACCTTCCGAGACCAGTCCACCTACATCAGGTCA GTTGTAGCCTGTGTCTCCCCTCCTGGGGACCTTCACCCCCTGGGAGGCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001081491 |
| Insert Size | 4000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001081491.1, NP_001074960.1 |
| RefSeq Size | 4147 bp |
| RefSeq ORF | 1071 bp |
| Locus ID | 10482 |
| UniProt ID | Q9UBU9 |
| Gene Summary | This gene is one member of a family of nuclear RNA export factor genes. Common domain features of this family are a noncanonical RNP-type RNA-binding domain (RBD), 4 leucine-rich repeats (LRRs), a nuclear transport factor 2 (NTF2)-like domain that allows heterodimerization with NTF2-related export protein-1 (NXT1), and a ubiquitin-associated domain that mediates interactions with nucleoporins. The LRRs and NTF2-like domains are required for export activity. Alternative splicing seems to be a common mechanism in this gene family. The encoded protein of this gene shuttles between the nucleus and the cytoplasm and binds in vivo to poly(A)+ RNA. It is the vertebrate homologue of the yeast protein Mex67p. The encoded protein overcomes the mRNA export block caused by the presence of saturating amounts of CTE (constitutive transport element) RNA of type D retroviruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) includes an alternate segment, compared to variant 1, resulting in a shorter protein (isoform 2) that has a distinct C-terminus, compared to isoform 1. CCDS Note: This CCDS ID represents the protein described in PMID: 16971948. This transcript is supported by AB209915.1. It should be noted this transcript is predicted to undergo nonsense-mediated mRNA decay (NMD). However, the protein is represented because it was detected endogenously in PMID: 16971948. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222620 | NXF1 (Myc-DDK-tagged)-Human nuclear RNA export factor 1 (NXF1), transcript variant 2 |
CNY 3,656.00 |
|
| RC222620L3 | Lenti ORF clone of Human nuclear RNA export factor 1 (NXF1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC222620L4 | Lenti ORF clone of Human nuclear RNA export factor 1 (NXF1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG222620 | NXF1 (tGFP-tagged) - Human nuclear RNA export factor 1 (NXF1), transcript variant 2 |
CNY 4,370.00 |
