United States
Germany
Japan
United Kingdom
China
PKM2 (PKM) (NM_002654) Human Untagged Clone
CAT＃: SC315792
PKM (untagged)-Human pyruvate kinase, muscle (PKM2), transcript variant 1
CNY 5,944.00
| Cited in 4 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CTHBP; HEL-S-30; OIP3; p58; PK3; PKM2; TCB; THBP1 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_002654 edited
ATGTCGAAGCCCCATAGTGAAGCCGGGACTGCCTTCATTCAGACCCAGCAGCTGCACGCA GCCATGGCTGACACATTCCTGGAGCACATGTGCCGCCTGGACATTGATTCACCACCCATC ACAGCCCGGAACACTGGCATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACG TTGAAGGAGATGATTAAGTCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACT CATGAGTACCATGCGGAGACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCT GACCCCATCCTCTACCGGCCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGA ACTGGGCTCATCAAGGGCAGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTC AAAATCACGCTGGATAACGCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGAC TACAAGAACATCTGCAAGGTGGTGGAAGTGGGCAGCAAGATCTACGTGGATGATGGGCTT ATTTCTCTCCAGGTGAAGCAGAAAGGTGCCGACTTCCTGGTGACGGAGGTGGAAAATGGT GGCTCCTTGGGCAGCAAGAAGGGTGTGAACCTTCCTGGGGCTGCTGTGGACTTGCCTGCT GTGTCGGAGAAGGACATCCAGGATCTGAAGTTTGGGGTCGAGCAGGATGTTGATATGGTG TTTGCGTCATTCATCCGCAAGGCATCTGATGTCCATGAAGTTAGGAAGGTCCTGGGAGAG AAGGGAAAGAACATCAAGATTATCAGCAAAATCGAGAATCATGAGGGGGTTCGGAGGTTT GATGAAATCCTGGAGGCCAGTGATGGGA:TCATGGTGGCTCGTGGTGATCTAGGCATTGA GATTCCTGCAGAGAAGGTCTTCCTTGCTCAGAAGATGATGATTGGACGGTGCAACCGAGC TGGGAAGCCTGTCATCTGTGCTACTCAGATGCTGGAGAGCATGATCAAGAAGCCCCGCCC CACTCGGGCTGAAGGCAGTGATGTGGCCAATGCAGTCCTGGATGGAGCCGACTGCATCAT GCTGTCTGGAGAAACAGCCAAAGGGGACTATCCTCTGGAGGCTGTGCGCATGCAGCACCT GATTGCCCGTGAGGCAGAGGCTGCCATCTACCACTTGCAATTATTTGAGGAACTCCGCCG CCTGGCGCCCATTACCAGCGACCCCACAGAAGCCACCGCCGTGGGTGCCGTGGAGGCCTC CTTCAAGTGCTGCAGTGGGGCCATAATCGTCCTCACCAAGTCTGGCAGGTCTGCTCACCA GGTGGCCAGATACCGCCCACGTGCCCCCATCATTGCTGTGACCCGGAATCCCCAGACAGC TCGTCAGGCCC:ACCTGTACCGTGGCATCTTCCCTGTGCTGTGCAAGGACCCAGTCCAGG AGGCCTGGGCTGAGGACGTGGACCTCCGGGTGAACTTTGCCATGAATGTTGGCAAGGCCC GAGGCTTCTTCAAGAAGGGAGATGTGGTCATTGTGCTGACCGGATGGCGCCCTGGCTCCG GCTTCACCAACACCATGCGTGTTGTTCCTGTGCCGTGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_002654 |
| Insert Size | 2550 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002654.3. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002654.3, NP_002645.3 |
| RefSeq Size | 2479 bp |
| RefSeq ORF | 1596 bp |
| Locus ID | 5315 |
| UniProt ID | P14618 |
| Domains | PK |
| Protein Families | Druggable Genome |
| Protein Pathways | Glycolysis / Gluconeogenesis, Metabolic pathways, Purine metabolism, Pyruvate metabolism, Type II diabetes mellitus |
| Gene Summary | This gene encodes a protein involved in glycolysis. The encoded protein is a pyruvate kinase that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate to ADP, generating ATP and pyruvate. This protein has been shown to interact with thyroid hormone and may mediate cellular metabolic effects induced by thyroid hormones. This protein has been found to bind Opa protein, a bacterial outer membrane protein involved in gonococcal adherence to and invasion of human cells, suggesting a role of this protein in bacterial pathogenesis. Several alternatively spliced transcript variants encoding a few distinct isoforms have been reported. [provided by RefSeq, May 2011] Transcript Variant: This variant (1) differs in the 5' UTR and coding sequence and has an alternate in-frame coding exon compared to variant 4. The resulting isoform (a, also called M2) is shorter at the N-terminus and has a different internal segment compared to isoform c. |
Citations (4)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
PolG Inhibits Gastric Cancer Glycolysis and Viability by Suppressing PKM2 Phosphorylation
,Lv, M;Zhang, S;Dong, Y;Cao, L;Guo, S;,
Cancer management and research
,PubMed ID 33623435
[PKM]
|
|
Atg7 inhibits Warburg effect by suppressing PKM2 phosphorylation resulting reduced epithelial-mesenchymal transition
,Feng, Y;Liu, J;Guo, W;Guan, Y;Xu, H;Guo, Q;Song, X;Yi, F;Liu, T;Zhang, W;Dong, X;Cao, L;O'Rourke, B;Cao, L;,
Int. J. Biol. Sci.
,PubMed ID 29910687
[PKM]
|
|
Pharmacologic Activation of PKM2 Slows Lung Tumor Xenograft Growth
,K. Mark Parnell, Jason M. Foulks, Rebecca N. Nix, Adrianne Clifford, Jeremy Bullough, Bai Luo, Anna Senina, David Vollmer, Jihua Liu, Virgil McCarthy, Yong Xu, Michael Saunders, Xiao-Hui Liu, Scott Pearce, Kevin Wright, Marc O'Reilly, Michael V. McCullar, Koc-Kan Ho, and Steven B. Kanner,
Mol. Cancer Ther., Aug 2013; 12: 1453 - 1460.
,PubMed ID 23720766
[PKM]
|
|
Reciprocal Regulation of Protein Kinase and Pyruvate Kinase Activities of Pyruvate Kinase M2 by Growth Signals
,Xueliang Gao, Haizhen Wang, Jenny J. Yang, Jing Chen, Jiang Jie, Liangwei Li, Yinwei Zhang, and Zhi-Ren Liu,
J. Biol. Chem., May 2013; 288: 15971 - 15979.
,PubMed ID 23576436
[PKM]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201855 | PKM (Myc-DDK-tagged)-Human pyruvate kinase, muscle (PKM2), transcript variant 1 |
CNY 5,928.00 |
|
| RC201855L1 | Lenti-ORF clone of PKM (Myc-DDK-tagged)-Human pyruvate kinase, muscle (PKM2), transcript variant 1 |
CNY 8,328.00 |
|
| RC201855L2 | Lenti-ORF clone of PKM (mGFP-tagged)-Human pyruvate kinase, muscle (PKM2), transcript variant 1 |
CNY 8,328.00 |
|
| RC201855L3 | Lenti-ORF clone of PKM (Myc-DDK-tagged)-Human pyruvate kinase, muscle (PKM2), transcript variant 1 |
CNY 8,328.00 |
|
| RC201855L4 | Lenti-ORF clone of PKM (mGFP-tagged)-Human pyruvate kinase, muscle (PKM2), transcript variant 1 |
CNY 8,328.00 |
|
| RG201855 | PKM (tGFP-tagged) - Human pyruvate kinase, muscle (PKM2), transcript variant 1 |
CNY 7,528.00 |
