United States
Germany
Japan
United Kingdom
China
Prion protein PrP (PRNP) (NM_001080122) Human Untagged Clone
CAT＃: SC315706
PRNP (untagged)-Human prion protein (PRNP), transcript variant 4
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AltPrP; ASCR; CD230; CJD; GSS; KURU; p27-30; PRIP; PrP; PrP27-30; PrP33-35C; PrPc |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC315706 representing NM_001080122.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGAACCTTGGCTGCTGGATGCTGGTTCTCTTTGTGGCCACATGGAGTGACCTGGGCCTCTGCAAG AAGCGCCCGAAGCCTGGAGGATGGAACACTGGGGGCAGCCGATACCCGGGGCAGGGCAGCCCTGGAGGC AACCGCTACCCACCTCAGGGCGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCAT GGTGGTGGCTGGGGGCAGCCCCATGGTGGTGGCTGGGGACAGCCTCATGGTGGTGGCTGGGGTCAAGGA GGTGGCACCCACAGTCAGTGGAACAAGCCGAGTAAGCCAAAAACCAACATGAAGCACATGGCTGGTGCT GCAGCAGCTGGGGCAGTGGTGGGGGGCCTTGGCGGCTACATGCTGGGAAGTGCCATGAGCAGGCCCATC ATACATTTCGGCAGTGACTATGAGGACCGTTACTATCGTGAAAACATGCACCGTTACCCCAACCAAGTG TACTACAGGCCCATGGATGAGTACAGCAACCAGAACAACTTTGTGCACGACTGCGTCAATATCACAATC AAGCAGCACACGGTCACCACAACCACCAAGGGGGAGAACTTCACCGAGACCGACGTTAAGATGATGGAG CGCGTGGTTGAGCAGATGTGTATCACCCAGTACGAGAGGGAATCTCAGGCCTATTACCAGAGAGGATCG AGCATGGTCCTCTTCTCCTCTCCACCTGTGATCCTCCTGATCTCTTTCCTCATCTTCCTGATAGTGGGA TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001080122 |
| Insert Size | 762 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001080122.1 |
| RefSeq Size | 2746 bp |
| RefSeq ORF | 762 bp |
| Locus ID | 5621 |
| UniProt ID | P04156 |
| Protein Families | ES Cell Differentiation/IPS, Stem cell - Pluripotency, Transmembrane |
| Protein Pathways | Prion diseases |
| MW | 27.7 kDa |
| Gene Summary | The protein encoded by this gene is a membrane glycosylphosphatidylinositol-anchored glycoprotein that tends to aggregate into rod-like structures. The encoded protein contains a highly unstable region of five tandem octapeptide repeats. This gene is found on chromosome 20, approximately 20 kbp upstream of a gene which encodes a biochemically and structurally similar protein to the one encoded by this gene. Mutations in the repeat region as well as elsewhere in this gene have been associated with Creutzfeldt-Jakob disease, fatal familial insomnia, Gerstmann-Straussler disease, Huntington disease-like 1, and kuru. An overlapping open reading frame has been found for this gene that encodes a smaller, structurally unrelated protein, AltPrp. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1-5 can all encode the same protein (Prp). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216189 | PRNP (Myc-DDK-tagged)-Human prion protein (PRNP), transcript variant 4 |
CNY 2,400.00 |
|
| RC216189L1 | Lenti ORF clone of Human prion protein (PRNP), transcript variant 4, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC216189L2 | Lenti ORF clone of Human prion protein (PRNP), transcript variant 4, mGFP tagged |
CNY 5,890.00 |
|
| RC216189L3 | Lenti ORF clone of Human prion protein (PRNP), transcript variant 4, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC216189L4 | Lenti ORF clone of Human prion protein (PRNP), transcript variant 4, mGFP tagged |
CNY 5,890.00 |
|
| RG216189 | PRNP (tGFP-tagged) - Human prion protein (PRNP), transcript variant 4 |
CNY 4,370.00 |
其它Prion protein PrP产品
