TMEM218 (NM_001080546) Human Untagged Clone
CAT#: SC315667
TMEM218 (untagged)-Human transmembrane protein 218 (TMEM218)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC315667 representing NM_001080546.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTGGCACTGTGCTCGGAGTCGGTGCGGGCGTGTTCATCTTAGCCCTGCTCTGGGTGGCAGTGCTG CTGCTGTGTGTGCTGCTGTCCAGAGCCTCCGGGGCGGCGAGGTTCTCTGTCATTTTTTTATTCTTCGGT GCTGTGATCATCACATCAGTTCTGTTGCTTTTCCCGCGAGCTGGTGAATTCCCAGCCCCAGAAGTGGAA GTTAAGATTGTGGATGACTTTTTCATTGGCCGCTATGTCCTGCTGGCTTTCCTTAGTGCCATCTTCCTT GGAGGCCTCTTCTTGGTTTTAATCCATTATGTTCTGGAGCCGATCTATGCCAAACCACTGCACTCCTAC TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001080546 |
Insert Size | 348 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001080546.2 |
RefSeq Size | 4037 bp |
RefSeq ORF | 348 bp |
Locus ID | 219854 |
UniProt ID | A2RU14 |
Protein Families | Transmembrane |
MW | 12.5 kDa |
Gene Summary | May be involved in ciliary biogenesis or function.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (8) has multiple differences, compared to variant 1. These differences result in a distinct 5' UTR and cause translation initiation at a downstream start codon, compared to variant 1. The encoded protein (isoform 2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213158 | TMEM218 (Myc-DDK-tagged)-Human transmembrane protein 218 (TMEM218) |
CNY 1,200.00 |
|
RC213158L3 | Lenti ORF clone of Human transmembrane protein 218 (TMEM218), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC213158L4 | Lenti ORF clone of Human transmembrane protein 218 (TMEM218), mGFP tagged |
CNY 5,890.00 |
|
RG213158 | TMEM218 (tGFP-tagged) - Human transmembrane protein 218 (TMEM218) |
CNY 2,800.00 |
其它TMEM218产品