PDE11A (NM_001077196) Human Untagged Clone

CAT#: SC315574

PDE11A (untagged)-Human phosphodiesterase 11A (PDE11A), transcript variant 1



  "NM_001077196" in other vectors (4)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
PDE11A Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PPNAD2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001077196, the custom clone sequence may differ by one or more nucleotides
ATGTCCCCAAAGTGCAGTGCTGATGCTGAGAACAGTTTCAAAGAAAGCATGGAGAAATCA
TCATACTCCGACTGGCTAATAAATAACAGCATTGCTGAGCTGGTTGCTTCAACAGGCCTT
CCAGTGAACATCAGTGATGCCTACCAGGATCCGCGCTTTGATGCAGAGGCAGACCAGATA
TCTGGTTTTCACATAAGATCTGTTCTTTGTGTCCCTATTTGGAATAGCAACCACCAAATA
ATTGGAGTGGCTCAAGTGTTAAACAGACTTGATGGGAAACCTTTTGATGATGCAGATCAA
CGACTTTTTGAGGCTTTTGTCATCTTTTGTGGACTTGGCATCAACAACACAATTATGTAT
GATCAAGTGAAGAAGTCCTGGGCCAAGCAGTCTGTGGCTCTTGATGTGCTATCATACCAT
GCAACATGTTCAAAAGCTGAAGTTGACAAGTTTAAGGCAGCCAACATCCCTCTGGTGTCA
GAACTTGCCATCGATGACATTCATTTTGATGACTTTTCTCTCGACGTTGATGCCATGATC
ACAGCTGCTCTCCGGATGTTCATGGAGCTGGGGATGGTACAGAAATTTAAAATTGACTAT
GAGACACTGTGTAGGTGGCTTTTGACAGTGAGGAAAAACTATCGGATGGTTCTATACCAC
AACTGGAGACATGCCTTCAACGTGTGTCAGCTGATGTTCGCGATGTTAACCACTGCTGGG
TTTCAAGACATTCTGACCGAGGTGGAAATTTTAGCGGTGATTGTGGGATGCCTGTGTCAT
GACCTCGACCACAGGGGAACCAACAATGCCTTCCAAGCTAAGAGTGGCTCTGCCCTGGCC
CAACTCTATGGAACCTCTGCTACCTTGGAGCATCACCATTTCAACCACGCCGTGATGATC
CTTCAAAGTGAGGGTCACAATATCTTTGCTAACCTGTCCTCCAAGGAATATAGTGACCTT
ATGCAGCTTTTGAAGCAGTCAATATTGGCAACAGACCTCACGCTGTACTTTGAGAGGAGA
ACTGAATTCTTTGAACTTGTCAGTAAAGGAGAATACGATTGGAACATCAAAAACCATCGT
GATATATTTCGATCAATGTTAATGACAGCCTGTGACCTTGGAGCCGTGACCAAACCGTGG
GAGATCTCCAGACAGGTGGCAGAACTTGTAACCAGTGAGTTCTTCGAACAAGGAGATCGG
GAGAGATTAGAGCTCAAACTCACTCCTTCAGCAATTTTTGATCGGAACCGGAAGGATGAA
CTGCCTCGGTTGCAACTGGAGTGGATTGATAGCATCTGCATGCCTTTGTATCAGGCACTG
GTGAAGGTCAACGTGAAACTGAAGCCGATGCTAGATTCAGTAGCTACAAACAGAAGTAAG
TGGGAAGAGCTACACCAAAAACGACTGCTGGCCTCAACTGCCTCATCCTCCCCTGCCAGT
GTTATGGTAGCCAAGGAAGACAGGAAC
Restriction Sites Please inquire     
ACCN NM_001077196
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001077196.1, NP_001070664.1
RefSeq Size 7786 bp
RefSeq ORF 1470 bp
Locus ID 50940
UniProt ID Q9HCR9
Protein Families Druggable Genome
Protein Pathways Progesterone-mediated oocyte maturation, Purine metabolism
Gene Summary The 3',5'-cyclic nucleotides cAMP and cGMP function as second messengers in a wide variety of signal transduction pathways. 3',5'-cyclic nucleotide phosphodiesterases (PDEs) catalyze the hydrolysis of cAMP and cGMP to the corresponding 5'-monophosphates and provide a mechanism to downregulate cAMP and cGMP signaling. This gene encodes a member of the PDE protein superfamily. Mutations in this gene are a cause of Cushing disease and adrenocortical hyperplasia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 4. The resulting isoform (1) has a shorter N-terminus, compared to isoform 4.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...