NTAL (LAT2) (NM_032464) Human Untagged Clone
CAT#: SC315496
LAT2 (untagged)-Human linker for activation of T cells family, member 2 (LAT2), transcript variant 1
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HSPC046; LAB; NTAL; WBSCR5; WBSCR15; WSCR5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC315496 representing NM_032464.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGCTCGGGGACTGAACTGCTGTGGCCCGGAGCAGCGCTGCTGGTGCTGTTGGGGGTGGCAGCCAGT CTGTGTGTGCGCTGCTCACGCCCAGGTGCAAAGAGGTCAGAGAAAATCTACCAGCAGAGAAGTCTGCGT GAGGACCAACAGAGCTTTACGGGGTCCCGGACCTACTCCTTGGTCGGGCAGGCATGGCCAGGACCCCTG GCGGACATGGCACCCACAAGGAAGGACAAGCTGTTGCAATTCTACCCCAGCCTGGAGGATCCAGCATCT TCCAGGTACCAGAACTTCAGCAAAGGAAGCAGACACGGGTCGGAGGAAGCCTACATAGACCCCATTGCC ATGGAGTATTACAACTGGGGGCGGTTCTCGAAGCCCCCAGAAGATGATGATGCCAATTCCTACGAGAAT GTGCTCATTTGCAAGCAGAAAACCACAGAGACAGGTGCCCAGCAGGAGGGCATAGGTGGCCTCTGCAGA GGGGACCTCAGCCTGTCACTGGCCCTGAAGACTGGCCCCACTTCTGGTCTCTGTCCCTCTGCCTCCCCG GAAGAAGATGAGGAATCTGAGGATTATCAGAACTCAGCATCCATCCATCAGTGGCGCGAGTCCAGGAAG GTCATGGGGCAACTCCAGAGAGAAGCATCCCCTGGCCCGGTGGGAAGCCCAGACGAGGAGGACGGGGAA CCGGATTACGTGAATGGGGAGGTGGCAGCCACAGAAGCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_032464 |
Insert Size | 732 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_032464.2 |
RefSeq Size | 2199 bp |
RefSeq ORF | 732 bp |
Locus ID | 7462 |
UniProt ID | Q9GZY6 |
Protein Families | Transmembrane |
MW | 26.6 kDa |
Gene Summary | This gene is one of the contiguous genes at 7q11.23 commonly deleted in Williams syndrome, a multisystem developmental disorder. This gene consists of at least 14 exons, and its alternative splicing generates 3 transcript variants, all encoding the same protein. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longest transcript. All three variants encode the same protein. CCDS Note: The coding region has been updated to represent an alternate splice pattern, resulting in an alternate and longer C-terminus that is better supported by available transcript and conservation data. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222806 | LAT2 (Myc-DDK-tagged)-Human linker for activation of T cells family, member 2 (LAT2), transcript variant 1 |
CNY 2,400.00 |
|
RC222806L3 | Lenti ORF clone of Human linker for activation of T cells family, member 2 (LAT2), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222806L4 | Lenti ORF clone of Human linker for activation of T cells family, member 2 (LAT2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG222806 | LAT2 (tGFP-tagged) - Human linker for activation of T cells family, member 2 (LAT2), transcript variant 1 |
CNY 4,370.00 |